Респираторно вирусная инфекция: причины, симптомы и лечение в статье инфекциониста Александров П. А.

Содержание

Острые Респираторные Вирусные Инфекции (ОРВИ)

ОРВИ – это острая респираторная вирусная инфекция. Вирусы ОРВИ являются самыми распространенными инфекционными заболеваниями. Объединяет их в одну группу присущее им свойство поражать различные отделы дыхательного тракта, что сопровождается интоксикацией, частым присоединением бактериальных осложнений, а также быстрота и легкость передачи возбудителей (воздушно-капельный путь), их высокая контагиозность и изменчивость.

ОРВИ вызываются РНК — и ДНК-содержащими вирусами.

Семейство Парамиксовирусы


Представители данного семейства — РНК-содержащие вирусы. Род Парамиксовирусы включает вирус парагриппа человека, респираторно-синцитиальный вирус (РС-В) и другие.

Парагрипп


Основной точкой приложения данного вируса является слизистая оболочка верхних дыхательных путей, в частности, гортани и бронхов.


Передается воздушно-капельным путем. Продолжительность инкубационного периода 2- 7 дней. Заболевание чаще всего начинается остро: пациента беспокоит скудное слизистое отделяемое из носа, боль в горле, осиплость, потеря голоса, грубый, сухой, дерущий кашель. Интоксикация выражена не сильно, температура редко превышает субфебрильные цифры (37,2-37,4). Опасность вирус парагриппа представляет для детей раннего возраста, в виду анатомических особенностей строения гортани и реактивности организма. Проявляется грубым «лающим» кашлем, одышкой, иногда стенозом гортани. Может также осложниться бронхиолитом и пневмонией. При не осложненном течении вирус парагриппа проходит в течение недели. Иммунитет не стойкий.

Респираторно-синцитиальный вирус


Другой представитель семейства парамиксовирусов — респираторно-синцитиальный вирус.


Основной точкой приложения РС-В являются нижние дыхательные пути 


Путь передачи — воздушно-капельный. 


Инкубационный период 2-7 дней.


РС-вирусная инфекция характеризуется постепенным началом, подъемом температуры, обильным отделяемым прозрачной слизи из полости носа, болью, першением в горле, развитием бронхитов, бронхиолитов (у детей), пневмонии. На этом фоне возможно формирование астматического синдрома. Взрослыми обычно переносится хорошо, купируется при не осложненном течении за неделю. Особую опасность представляет для детей первых лет жизни в виду высокого риска развития бронхообструктивного синдрома.


Иммунитет не стойкий.

Семейство Коронавирусы


Особенностью этого семейства вирусов является способность вызывать у людей как острые респираторные, так и кишечные заболевания.


Семейство включает 13 видов вирусов: респираторные и энтеральные коронавирусы человека и животных. При коронавирусной инфекции чаще всего развивается острый обильный водянистый насморк, без повышения температуры. Иногда — головная боль, кашель, боль, першение в горле . У детей (особенно раннего возраста) может протекать более выражено. Поражение эпителия желудочно-кишечного тракта, проявляется клиникой гастроэнтерита.


Коронавирусные инфекции носят сезонный характер и распространены в основном в осенне-зимний период.

Семейство Пикорнавирусы


Включает в себя риновирусы и энтеровирусы.


Риновирусная инфекция


Основная точка приложения — слизистая оболочка носа и околоносовых пазух Одна из самых частых вирусных инфекций осенне-зимнего периода.


Инкубационный период 1-6 дней. Путь передачи — воздушно-капельный. Заболевание чаще всего начинается с выраженного зуда в полости носа, чихания, обильного, беспрерывного слизистого отделяемого из носа. Часто это приводит к образованию мацераций кожи вокруг входа в полость носа, над верхней губой. Продолжительность болезни обычно не более 7 суток. Интоксикация, субфебрилитет развивается редко. У детей возможна лихорадка, у взрослых повышение температуры наблюдается редко.


Энтеровирусы (Вирусы Коксаки В и ЕСНО)


Особенностью этих вирусов является поражение  эпителиальных клеток и лимфоидных образованиях респираторного тракта и кишечника.


Имеет множество клинических проявлений в связи с тропизмом вирусов ко многим органам и тканям человека.


Инкубационный период 2-10 дней. Путь передачи — воздушно-капельный и фекально-оральный.


Одной из множества клинических форм является Коксаки- и ЕСНО-лихорадка. Заболевание начинается остро. Температура может подняться до фебрильных цифр (38-39 С). Интоксикация выражена. Беспокоит головная боль, ломота в теле, боль в руках, ногах, нередко — рвота, боли в животе. Сопровождается это не обильными слизистыми выделениями из полости носа, болью, дискомфортом в горле, резью в глазах, покраснением склер, увеличением регионарных лимфоузлов, печени, селезенки.

Семейство Аденовирусы


Особенностью аденовирусов является поражение слизистой полости ротоглотки и склер, с развитием ринофаринготонзиллита, конъюнктивита, мезаденита.


В отличие от предыдущих групп возбудителей ОРВИ аденовирусы относятся к ДНК-содержащим.


Инкубационный период 2-12 дней. Основной путь передачи — воздушно-капельный, фекально-оральный.


Заболевание начинается остро. Интоксикация достаточно выражена, лихорадка может достигать фебрильных цифр. Больного беспокоит слизистое отделяемое из носа, выраженная боль в горле, отечность, покраснение миндалин, наличие налета на миндалинах. Резь, боль в глазах, покраснение склер, кашель, осиплость. Также могут беспокоить боли в животе, дисфункция желудочно-кишечного тракта.


Длительность инфекционного периода — до двух недель.


Отягчающим обстоятельством является длительное персистирование вируса в эпителии миндалин, что может приводить к реактивации инфекции и хроническому вялотекущему течению.

Диагностика и лечение ОРВИ


При появлении симптоматики ОРВИ необходимо обратиться к врачу для уточнения диагноза и определения корректного лечения.


Нередко наблюдается затягивание пациентами начала лечения, нерациональное самостоятельное применение лекарственных препаратов, в том числе и антибактериальных, что приводит к появлению осложнений.


Следует обратить внимание пациентов на распространенные ошибки самолечения:

  • Антибактериальные препараты (антибиотики) не влияют на жизнедеятельность вирусов, а нерациональный прием таких лекарств вызывает устойчивость патогенной флоры;
  • Прием антипиретиков (средств, снижающих температуру) не является лечением инфекции, кажущееся улучшение самочувствие обманчиво и опасно развитием осложнений;
  • Нерациональное, длительное применение сосудосуживающих препаратов может привести к медикаментозному риниту;
  • Перед приемом любых лекарственных препаратов желательно проконсультироваться с лечащим врачом;
  • При ОРВИ рекомендован постельный режим, щадящая, витаминизированная диета, обильное питье, ограничение физических и эмоциональных нагрузок.

Острая респираторная вирусная инфекция: причины, диагностика — Онлайн-диагностика

Медучреждения, в которые можно обратиться

Общее описание

Острая респираторная вирусная инфекция (ОРВИ) — это группа инфекционных заболеваний вирусной этиологии с преимущественным поражением органов дыхания.

Острые респираторные вирусные инфекции — наиболее распространенная патология в мире. Возбудителями ОРВИ являются в большинстве случаев респираторные вирусы, которые вызывают разнообразные по локализации поражения дыхательного тракта. Заражение человека, как правило, происходит воздушно-капельным путем при контакте с больным ОРВИ.

Воздействуя на слизистую оболочку дыхательных путей, вирусы вызывают гиперсекрецию слизи, отек, повреждение дыхательного эпителия, дистрофию и некроз клеток, нарушение мукоцилиарного клиренса. В зависимости от возбудителя выделяют следующие вирусные инфекции:

  • Грипп.
  • Парагрипп.
  • Риновирусная инфекция.
  • Аденовирусная инфекция.
  • Респираторно-синцитиальная инфекция.
  • Реовирусная инфекция.

Клиника острой респираторной вирусной инфекции

Независимо от этиологии ОРВИ клинические проявления этих заболеваний относительно похожи и характеризуются синдромом интоксикации, лихорадкой и катаральными явлениями со стороны верхних и/или нижних дыхательных путей. Однако для каждой вирусной инфекции имеются свои особенности. При парагриппе чаще поражаются слизистые оболочки носа и гортани, признаки интоксикации выражены слабо. Клинически на первый план выступают симптомы ринита и ларингита (грубый сухой кашель, заложенность носа, охриплость голоса, шумное дыхание, стеноз гортани). Для риновирусной инфекции характерно преимущественно поражение слизистой оболочки полости носа. Это заболевание протекает с незначительной интоксикацией и обильным слизистым отделяемым из носа. При аденовирусной инфекции поражаются лимфоидная ткань носоглотки, лимфоузлы и конъюнктива глаз. Заболевание развивается постепенно и характеризуется постепенным подъемом температуры, катаральным синдромом с выраженным экссудативным компонентом, полиаденитом и конъюнктивитом, который является типичным проявлением этой инфекции. При респираторно-синцитиальной инфекции поражаются преимущественно нижние дыхательные пути, что проявляется дыхательной недостаточностью в форме бронхиолита и обструктивного бронхита при слабо выраженной интоксикации и лихорадке. Реовирусная инфекция характеризуется поражением верхних дыхательных путей и тонкого кишечника. В клинике инфекции регистрируются снижение аппетита, головная боль, насморк, кашель, тошнота, рвота и урчание в животе.

Диагностика острой респираторной вирусной инфекции

Диагноз ОРВИ ставится на основании эпидемического анамнеза, клинических проявлений и лабораторной диагностики, которая включает иммунофлюоресцентный и иммуноферментный методы обнаружения антигенов респираторных вирусов, а также серологические методы (РНГА, РСК). Для анализа крови характерны лейкопения и лимфоцитоз.

Лечение острой респираторной вирусной инфекции

Консервативная терапия ОРВИ включает этиотропное лечение в первые дни заболевания и симптоматические препараты. Этиотропная терапия проводится в зависимости от тяжести ОРВИ: «Интерферон», «Гриппферон» (капли в нос), «Арбидол» внутрь, «Амиксин» внутрь, «Виферон» в свечах. Симптоматическое лечение включает противокашлевые и отхаркивающие средства (лекарственные травы, «Бромгексин», «АЦЦ»), жаропонижающие препараты (кратковременно!) при температуре тела свыше 38,5 °C («Парацетамол», «Ибупрофен»). Дополнительно назначают обильное питье, молочно-растительную диету, витамины, по показаниям — иммунокорректоры («Рибомунил», «Бронхомунал», «Имудон»).

Основные лекарственные препараты

Имеются противопоказания. Необходима консультация специалиста.

  • Озельтамивир (противовирусное средство). Режим дозирования: внутрь, взрослым и де-тям старше 12 лет — в дозе 75 мг 2 раза в сутки в течение 5 дней.
  • Ремантадин (противовирусное средство). Режим дозирования: внутрь, после еды, в 1-е сутки — по 100 мг 3 раза (или 300 мг однократно), во 2-й и 3-й день — по 100 мг 2 раза, в 4-й день — 100 мг 1 раз. В качестве профилактического средства — по 50 мг 1 раз в день в течение 10-15 дней.
  • Тамифлю (противовирусное средство). Режим дозирования: внутрь, независимо от приема пищи. Прием препарата необходимо начинать не позднее 2 сут. от момента развития симптомов заболевания. Взрослые и подростки ≥ 12 лет по 75 мг (капсулы или суспензия) 2 раза в сутки внутрь в течение 5 дней.
  • Гриппферон (иммуномодулирующее, противовоспалительное, противовирусное средство). Режим дозирования: интраназально, с 15 лет и взрослым — по 3 капли/дозы в каждый носовой ход 5-6 раз в день (разовая доза — 3000 ME, суточная доза — 15000-18000 ME). От первых признаков заболевания препарат применяют в течение 5 дней.
  • Амиксин (иммуномодулирующее, противовирусное средство). Режим дозирования: внутрь, после еды. В первые 2 сут. болезни — по 0,125 г, затем по 0,125 г через день. На курс лечения гриппа — 0,75 г.
Ведущие специалисты и учреждения по лечению данного заболевания в России:
профессор д.м.н. Малеев, НИИ эпидемиологии, Москва.

Еще статьи по данной теме

Заболеваемость (на 100 000 человек)

Мужчины Женщины
Возраст,
лет
0-1 1-3 3-14 14-25 25-40 40-60 60 + 0-1 1-3 3-14 14-25 25-40 40-60 60 +
Кол-во
заболевших
5000 15000 10000 10000 10000 10000 9000 5000 15000 10000 10000 10000 10000 9000

Что нужно пройти при подозрении на заболевание

  • 1. Флюорография
  • Флюорография

    Трактовка флюорографического заключения «усиление легочного (сосудистого) рисунка» наблюдается при остром воспалении любого происхождения, в том числе и ОРВИ. Усиление легочного рисунка при воспалительных заболеваниях, как правило, исчезает в течение нескольких недель после перенесенного заболевания.

Симптомы

  • Лия
    2018-03-30 02:53:00

    Добрый день! У меня температура 37,1-37,5 держится почти год, при этом только ужасно болит каждый день голова. Врачи не могут поставить диагноз. Сдала всевозможные анализы, в госпитализации…
  • Максим
    2018-03-06 14:22:40

    Помогите вылечится от болезни
    В пятницу я заболел
    И уже 5 день температура не меньше 37°, а вечером растет до 39°, к врачу сходить не получается
    Так же болит горло, кашель, насморк и порой даже…
  • Ирина
    2017-11-12 04:49:08

    Здравствуйте! Подскажите, пожалуйста, у моему ребенка 4 года, вес 15, рост 102, очень худенький, проблемы со стулом с рождения, дефекация происходит 1 в 5 дней, если началась, то и на следующий день…
  • Олеся
    2017-10-25 01:38:41

    Здравствуйте. Уже почти месяц не проходит сухой кашель, который в основном мучает ночью и заложен нос. ольше никаких симптомов нет. В целом чувствую себя нормально. Горло не болит. Только сухой…
  • Наталья
    2017-04-12 20:44:22

    Добрый день, 5 дней держится температура 38,5-39,5, сбиваю парацетамолом, спадает до 37,5 примерно часов на 5, кроме этого симптома — головная боль. Горло немного красное, других симптомов нет. Сдала…
  • Ирина
    2017-03-22 23:43:11

    здравствуйте, у меня все симтомы орви,заложен нос,температура 37. 5, сухой кашель, красное горло,но есть еще боли при вдохе и движении правой части груди,рядом с подмышкой. Рентген и прослушивание…
  • владимир
    2017-02-26 14:30:32

    подскажите пожалуйста,
    У меня симптомы: боль и сильное хрипение в бронхах, кашель иногда сухой иногда с мокротой, Постоянная заложеность носа и чихание.
    Каков диагноз на ваш взгляд?
  • александр
    2017-02-07 20:54:47

    здравствуйте. ребенку 2,10м. симптомы: рвота каждые 2-3 часа, температура 38,1. кашель влажный отхаркивающий.слабость, глаза красноватые
  • Aндрей
    2017-01-28 16:10:46

    Постоянный сухой кашель по утрам. К вечеру проходит. Что принять из лекарств?
  • Irina K.
    2017-01-28 14:03:39

    Добрый день. Сегодня 4 день болею простудой. Вчера сдала анализ крови чтобы понять это бактер. или вирусная природа заболевания. По анализу все показатели в норме, кроме СОЭ(она 23 при норме до 10)…
  • Артур
    2016-12-08 01:49:31

    Здравствуйте. Заболела моя девушка. Ей 17 лет. Диагноз — Острая вирусная инфекция.
    Симптомы — кашель(сухой) насморк, температура 38-39.5. Тело ломает. Второй день данная ситуация.
    Положили в…
  • Руслан
    2016-11-13 22:42:32

    Здравствуйте! Чуть больше месяц назад заболел ОРВИ. Было красное горло но не болело, очень сильный насморк и першение в носоглотке, один день поднялась температура до 38.7. Дальше не измерял. Брызгал…
  • Светлана
    2016-11-07 20:40:04

    Добрый день.
    Уже чуть больше недели мучает сухой иногда переходящий во влажный кашель. Началось все с першения в горле, затем несколько дней кашель заставлял просыпаться несколько раз ночью, потом…
  • Анна
    2016-10-11 19:45:13

    Здравствуйте. Ситуация такая — заболел ребенок 1,8. все началось с поноса со слизью и сразу зеленых соплей. на след. день поднялась температура 38,5, напоили компотом и она упала. и уже 4 дня то…
  • Ольга Л.
    2016-09-27 15:30:46

    Здравствуйте ,держится температура 38 ,и головная боль не проходит ,что это может быть?
  • Руфина
    2016-08-29 23:07:07

    Здраствуйте! Дочке поставили диагноз »острый назофаренгит»ей 1год. Назначено лечение мы выполняем все как надо. Но ещё сказали инголяцию делать,она очень капризная и не поддастся, я и не купила…
  • Полина
    2016-08-16 10:26:24

    Здравствуйте. Расшифруйте пожалуйста иммунологический анализ крови ИАК ребенка 3 лет. Т-лимфоциты — 66 В- лимфоциты — 40 Т-хелперы -40 Т-супрессоры- 26 IgA — 1.75 Ig G — 20.44 IgM 1.81 Cпасибо
  • Анна
    2016-06-26 19:48:51

    Здравствуйте,мы приехали отдыхать на море и через 3дня у ребёнка 4 лет начался кашель влажный ,насморк,затем через 2 дня повысилась температура до 37,7-38,5, перед этим появилась сыпь на животе в…
  • Александр
    2016-04-18 15:02:53

    Здравствуйте! У меня вторую неделю держится повышенная температура 37, 37. 1 36,9
    Ломота в теле, насморк с кровяными выделениями.
    Сухой кашель, не приятное ощущение при глотании в области щитовидной…
  • сергей
    2016-02-08 22:52:39

    здравствуйте. чуть больше недели першение и боль в горле, температура 36.7, сухой кашель отдающий в голову и усиливающийся по вечерам и при принятии телом горизонтального положения. общая слабость…
  • Роман
    2016-01-27 14:24:12

    Девочка 2. 3 года, неделю назад в среду повысилась темп.до 39 поставили свечу нурофен, темп.спала, общее состояние вялое но не капризной, покраснение глаз, на след день в четверг повторное повышение…
  • Юлия
    2016-01-13 21:56:06

    Здравствуйте! 2 недели назад простудилась (переохлаждение) и лечилась в основном травяным спреем для горла, горячим молоком, перцовым пластырем…Тревожит: кашель ночью и с утра (чаще), голос чуть…
  • ГАЛИНА
    2015-12-18 02:38:57

    ребенок 12 лет болеет 6 нед. выпили 3 антибиотика, 1прокололи просила в больнице отправить к инфекционисту сказали нет показаний сдали в частном порядке Эпштейна-Барр результат IgG 146,3…
  • Павел
    2015-09-21 11:09:20

    Здравствуйте,
    Заболел 7-8 сентября: першение в горле, неприятное ощущение.
    10 сентября в небольшом количестве употреблял спиртное (четверть бутылки вина). 11 сентября проснулся с теми же симптомами и…
  • Заур Г.
    2015-08-25 20:49:06

    Здраствуйте. Я Вам пишу из Баку. Ребенка 5 лет. Уже 18 дней повышенная температура тела (38-39,6). В начальном стадии 2-3 дня у него был панос (3 раз в день), но патом мы делали диету. сейчас у него…
  • Александр
    2015-07-05 11:27:46

    Здравствуйте! У меня третий день температура 38,5, кашля или насморка нет, рвоты нет, аппетит нормальный. Если завтра утром ничего не изменится, пойду к врачу. Просто хотелось бы знать к чему…
  • Виталий
    2015-05-25 01:04:10

    После перенесенной ОРВИ долго не проходит сухой кашель. Картина не меняется уже с неделю, просто сухой очень неприятный, надсадный кашель, иногда закашливаюсь надолго. Иногда кашель на несколько…
  • Ольга
    2015-02-27 12:59:50

    поставили диагноз ОРЗ,пропила Арбидол 7 дней. Температура не прекратилась.утром и вечером поднимается на пару часов,днем ее нет.Общее недомогание при температуре и заложенность носа.Температура…
  • Кирилл
    2015-02-16 22:56:41

    Здравствуйте, скажите пожалуйста как эффективно остановить ОРЗ на начальном этапе?
  • Андрей
    2015-02-10 19:52:25

    Здравствуйте. Как лечиться от гриппа при гастрите?
    Уже забыл про свой хронический гастрит, но тут грипп прихватил. Выпил Анти-макс порошок и час валялся от диких болей в желудке. Спас прием 5…
  • Андрей
    2014-07-17 21:47:26

    Какая частота ОРЗ является нормальной? Если болеешь чаще чем раз в пол года нужно ли проконсультироваться с иммунологом?
  • РЕСПИРАТОРНЫЕ ВИРУСНЫЕ БОЛЕЗНИ — Большая Медицинская Энциклопедия

    Респираторные вирусные болезни (лат. respiratio дыхание) — группа вирусных болезней, характеризующихся преимущественным поражением слизистых оболочек дыхательных путей.

    К числу Респираторных вирусных болезней относят грипп (см.), парагриппозные болезни (см.), аденовирусные болезни (см.), респираторно-синцитиальную инфекцию (см.), риновирусную болезнь (см.), коксаки-вирусные болезни (см.), болезни, вызываемые коронавирусами (см. Коронавирусы).

    После открытия вируса гриппа (1933) возникло мнение о различной этиологии первичных острых инфекционных болезней дыхательных путей. В 1938 г. Стюарт-Харрис (С. H. Stuart-Harris) и А. А. Смородинцев предложили разделить Респираторные вирусные болезни на грипп, вызываемый соответствующими вирусами, и так наз. катар верхних дыхательных путей неизвестной в то время этиологии. Роу, Хюбнер (W. P. Rowe, R. J. Huebner) с сотр. в 1953 г. выделили из ткани аденоидов возбудитель, названный аденовирусом. Позднее использование в вирусологической практике методов тканевых культур позволило выделить из дыхательных путей человека много новых вирусов — возможных возбудителей Р. в. б.

    Респираторные Вирусные Болезни вызываются вирусами, относящимися к различным семействам и обладающими выраженным тропизмом к эпителию слизистой оболочки дыхательных путей. Источником инфекции при Р. в. б. является только человек — больной или носитель. Передача вируса от человека к человеку происходит преимущественно воздушно-капельным путем; возможно заражение через инфицированные предметы обихода (посуда, полотенце, игрушки и др.).

    Респираторные Вирусные Болезни встречаются во всех странах мира, чаще в средних широтах; отмечаются выраженные сезонные (весна, осень) подъемы заболеваемости, чему способствует охлаждение организма. Восприимчивы к Р. в. б. люди всех возрастов, особенно дети. После перенесенной болезни возникает кратковременный специфический иммунитет.

    Респираторные Вирусные Болезни характеризуются острым началом с повышением температуры, сопровождаются поражением верхних дыхательных путей; течение их обычно кратковременное. Возможны осложнения — отит (см. ), пневмония (см.), менингит (см.) И др.

    Клинический диагноз для группы в целом не вызывает затруднений, но окончательный диагноз может быть поставлен только с помощью лабораторных методов исследования: реакции связывания комплемента (см.), реакции непрямой гемагглютинации, реакции торможения гемагглютинации (см.), иммунофлюоресценции в прямой или непрямой модификации (см. Иммунофлюоресценция), при выделении и идентификации вируса-возбудителя (см. Вирусологические исследования, Идентификация вирусов).

    Для лечения Респираторных Вирусных Болезней используются патогенетические и симптоматические средства, при бактериальных осложнениях (напр., при пневмонии) назначают антибиотики.

    Прогноз обычно благоприятный, однако при осложненных формах возможны летальные исходы.

    Профилактика состоит в систематической влажной уборке и проветривании помещений; в детских учреждениях рекомендуется использование бактерицидных ламп (в отсутствие детей). Важное значение имеет повышение неспецифической сопротивляемости организма — физкультура, спорт, прогулки на свежем воздухе, рациональное питание, назначение витаминов по показаниям. Важной мерой предупреждения вспышки заболевания является своевременное выявление больных в общежитиях и детских учреждениях и помещение их в изолятор. В квартире больного следует укладывать в отдельной комнате или отгораживать его кровать ширмой. Для заболевших выделяют отдельную посуду, полотенце, предметы ухода; после употребления посуду кипятят в 1% р-ре бикарбоната натрия. Госпитализируют только больных с тяжелыми и осложненными формами болезни. В родильных домах, детских консультациях, поликлиниках, больницах персонал должен пользоваться марлевыми повязками (масками).

    Специфическая профилактика разработана только в отношении гриппа.

    Библиография: Вирусы гриппа и грипп, под ред. Э. Д. Кильбурна, пер. с англ., М., 1978; Дяченко С. С., Синяк К. М. и Дяченко Н. С. Патогенные вирусы человека, с. 161, 402, Киев, 1980; Злыдников Д. М., Казанцев А. П. и Старшов П. Д. Терапия вирусных болезней, Л., 1979; Руководство по инфекционным болезням, под ред. В. И. Покровского и К. М. Лобана, с. 335, М., 1977; The influenza viruses and influenza, ed. by D. Kilbourne, p. 483, N. Y.— L., 1975.

    Острые респираторные вирусные инфекции (ОРВИ) | EUROLAB

    Острые респираторные вирусные инфекции (ОРВИ) — группа острых инфекционных заболеваний, вызываемых РНК- и ДНК-содержащими вирусами и характеризующихся поражением различных отделов дыхательного тракта, интоксикацией, частым присоединением бактериальных осложнений.

    ОРВИ — самое распространённое заболевание, в том числе у детей. Даже в неэпидемические годы регистрируемая заболеваемость ОРВИ во много раз превышает заболеваемость всеми основными инфекционными болезнями. В период пандемий за 9-10 мес в эпидемический процесс вовлекается более 30% населения земного шара, причём более половины из них составляют дети. Заболеваемость среди детей различных возрастных групп может отличаться в зависимости от свойств вируса, вызвавшего эпидемию. Однако в большинстве случаев наиболее высокий уровень заболеваемости отмечают у детей от 3 до 14 лет. ОРВИ нередко протекают с осложнениями (присоединением воспалительных процессов в бронхах, лёгких, околоносовых пазухах и т.д.) и вызывают обострения хронических заболеваний. Перенесённые ОРВИ обычно не оставляют после себя длительного стойкого иммунитета. Кроме того, отсутствие перекрёстного иммунитета, а также большое количество серотипов возбудителей ОРВИ способствуют развитию заболевания у одного и того же ребёнка несколько раз в год. Повторные ОРВИ приводят к снижению общей сопротивляемости организма, развитию транзиторных иммунодефицитных состояний, задержке физического и психомоторного развития, вызывают аллергизацию, препятствуют проведению профилактических прививок и т.д. Весьма значимы и экономические потери, обусловленные ОРВИ, — как прямые (лечение и реабилитация больного ребёнка), так и непрямые (связанные с нетрудоспособностью родителей). Все перечисленные выше обстоятельства объясняют приоритетность этой проблемы для здравоохранения любой страны.

    Этиология

    Возбудителями ОРВИ могут быть вирусы гриппа (типы А, В, С), парагриппа (4 типа), аденовирус (более 40 серотипов), РСВ (2 серовара), рео- и риновирусы (113 сероваров). Большинство возбудителей — РНК-содержащие вирусы, исключение составляет аденовирус, в вирион которого входит ДНК. Длительно сохраняться в окружающей среде способны рео- и аденовирусы, остальные быстро гибнут при высыхании, под действием УФО, обычных дезинфицирующих средств.

    Помимо перечисленных выше возбудителей ОРВИ, часть заболеваний этой группы может быть обусловлена энтеровирусами типа Коксаки и ECHO.

    Эпидемиология

    Болеют дети любого возраста. Источник инфекции — больной человек. Пути передачи инфекции — воздушно-капельный и контактно-бытовой (реже). Естественная восприимчивость детей к ОРВИ высокая. Больные наиболее контагиозны в течение 1-й недели заболевания. Для ОРВИ характерна сезонность — пик заболеваемости приходится на холодное время года. После перенесённого заболевания формируется типоспецифический иммунитет. ОРВИ распространены повсеместно. Крупные эпидемии гриппа возникают в среднем 1 раз в 3 года, их обычно вызывают новые штаммы вируса, но возможна рециркуляция сходных по антигенному составу штаммов после нескольких лет их отсутствия. При ОРВИ другой этиологии в основном регистрируют спорадические случаи и небольшие вспышки в детских коллективах, эпидемий практически не бывает.

    Патогенез ОРВИ

    Входными воротами инфекции чаще всего служат верхние дыхательные пути, реже конъюнктива глаз и пищеварительный тракт. Все возбудители ОРВИ эпителиотропны. Вирусы адсорбируются (фиксируются) на эпителиальных клетках, проникают в их цитоплазму, где подвергаются ферментативной дезинтеграции. Последующая репродукция возбудителя приводит к дистрофическим изменениям клеток и воспалительной реакции слизистой оболочки в месте входных ворот. Каждое заболевание из группы ОРВИ имеет отличительные черты в соответствии с тропностью тех или иных вирусов к определённым отделам дыхательной системы. Вирусы гриппа, РСВ и аденовирусы могут поражать эпителий как верхних, так и нижних дыхательных путей с развитием бронхита, бронхиолита и синдрома обструкции дыхательных путей, при риновирусной инфекции преимущественно поражается эпителий носовой полости, а при парагриппе — гортани. Кроме того, аденовирусы обладают тропностью к лимфоидной ткани и эпителиальным клеткам слизистой оболочки конъюнктивы.

    Через повреждённые эпителиальные барьеры возбудители ОРВИ проникают в кровоток. Выраженность и продолжительность фазы вирусемии зависит от степени дистрофических изменений эпителия, распространённости процесса, состояния местного и гуморального иммунитета, преморбидного фона и возраста ребёнка, а также от особенностей возбудителя. Продукты распада клеток, поступающие наряду с вирусами в кровь, оказывают токсическое и токсико-аллергическое действия. Токсическое действие в основном направлено на ЦНС и сердечно-сосудистую систему. Из-за нарушений микроциркуляции возникают гемодинамические расстройства в различных органах и системах. При наличии предшествующей сенсибилизации возможно развитие аллергических и аутоаллергических реакций.

    Поражение эпителия дыхательных путей приводит к нарушению его барьерной функции и способствует присоединению бактериальной флоры с развитием осложнений.

    Клиническая картина

    Интоксикация и лихорадка наиболее выражены при гриппе. Парагрипп протекает с менее выраженной интоксикацией и кратковременной вирусемией, но опасен, особенно для детей раннего возраста, в связи с частым развитием ложного крупа. Аденовирусную инфекцию отличают постепенно нисходящее поражение дыхательных путей, репродукция вируса не только в эпителии, но и в лимфоидной ткани, длительная вирусемия, возможность размножения вируса в энтероцитах с развитием диареи. Респираторно-синцитаильый вирус поражает мелкие бронхи и бронхиолы, что приводит к нарушению вентиляции лёгких и способствует возникновению ателектазов и пневмоний.

    Общепринятая классификация ОРВИ у детей отсутствует. По тяжести течения различают лёгкую, сред нетяжёлую, тяжёлую и гипертоксическую формы (последнюю выделяют при гриппе). Тяжесть заболевания определяется выраженностью симптомов интоксикации и катаральных явлений.

    Грипп

    Продолжительность инкубационного периода составляет от нескольких часов до 1-2 дней. Особенность начального периода гриппа — преобладание симптомов интоксикации над катаральными. В типичных случаях заболевание начинается остро, без продромального периода, с повышения температуры тела до 39-40 °С, озноба, головокружения, общей слабости, ощущения разбитости. У детей раннего возраста интоксикация проявляется лихорадкой, вялостью, адинамией, ухудшением аппетита. Дети старшего возраста жалуются на головную боль, светобоязнь, боли в глазных яблоках, животе, мышцах, суставах, ощущение разбитости, першение в горле, жжение за грудиной, иногда появляются рвота и менингеальные знаки. Катаральные явления в разгар болезни обычно выражены умеренно и ограничиваются сухим кашлем, чиханьем, скудным слизистым отделяемым из носа, умеренной гиперемией слизистой оболочки зева, «зернистостью» задней стенки глотки. Иногда обнаруживают точечные кровоизлияния на мягком нёбе. Часто наблюдают лёгкую гиперемию лица и инъекцию сосудов склер, реже — носовые кровотечения. Отмечают тахикардию и приглушённость сердечных тонов. При выраженном токсикозе наблюдают транзиторные изменения со стороны мочевыделительной системы (микроальбуминурию, микрогематурию, снижение диуреза).

    Состояние больных улучшается с 3-4-го дня болезни: температура тела становится ниже, интоксикация уменьшается, катаральные явления могут сохраняться и даже усиливаться, окончательно они исчезают через 1,5-2 нед. Характерная черта гриппа — длительная астения в период реконвалесценции, проявляющаяся слабостью, быстрой утомляемостью, потливостью и другими признаками, сохраняющимися несколько дней, иногда недель.

    В тяжёлых случаях возможно развитие геморрагического бронхита и пневмонии, возникающих в течение нескольких часов. Иногда в течение 2 сут от начала заболевания наблюдают прогрессивное усиление одышки и цианоза, кровохарканье, развитие отёка лёгких. Так манифестирует молниеносная вирусная или смешанная вирусно-бактериальная пневмония, нередко заканчивающаяся летально.

    Показатели общего анализа крови: со 2-3-го дня болезни — лейкопения, нейтропения, лимфоцитоз при нормальной СОЭ.

    Парагрипп

    Продолжительность инкубационного периода составляет 2-7 дней, в среднем 2-4 дня. Заболевание начинается остро с умеренного повышения температуры тела, катаральных явлений и незначительной интоксикации. В последующие 3-4 дня все симптомы нарастают. Температура тела обычно не превышает 38-38,5 °С, редко сохраняясь на таком уровне более 1 нед.

    Катаральное воспаление верхних дыхательных путей — постоянный признак парагриппа с первых дней болезни. Отмечают сухой грубый «лающий» кашель, осиплость и изменение тембра голоса, саднение и боли за грудиной, боль в горле, насморк. Выделения из носа бывают серозно-слизистыми. При осмотре больного выявляют гиперемию и отёчность миндалин, нёбных дужек, зернистость слизистой оболочки задней стенки глотки. Часто первым проявлением парагриппа у детей 2-5 лет выступает синдром крупа. Внезапно, чаще ночью, появляются грубый «лающий» кашель, осиплость голоса, шумное дыхание, т.е. развивается стеноз гортани. Иногда эти симптомы появляются на 2-3-й день болезни. У детей раннего возраста при парагриппе возможно поражение не только верхних, но и нижних дыхательных путей; в этом случае развивается картина обструктивного бронхита. При неосложнённом течении парагриппа продолжительность болезни составляет 7-10 дней.

    Острая респираторная вирусная инфекция — Википедия

    О́страя респирато́рная ви́русная инфе́кция (ОРВИ) — группа клинически и морфологически подобных острых воспалительных заболеваний органов дыхания, возбудителями которых являются пневмотропные вирусы. ОРВИ — самая распространённая в мире группа заболеваний, объединяющая респираторно-синцитиальную инфекцию, риновирусную и аденовирусную инфекции и другие катаральные воспаления верхних дыхательных путей[1][2]. В процессе развития вирусное заболевание может осложняться бактериальной инфекцией.

    Эпидемиология

    ОРВИ встречаются повсеместно и являются самым распространённым инфекционным заболеванием, поэтому полностью учесть заболеваемость невозможно. Дети первых месяцев жизни практически не болеют (благодаря относительной изоляции и пассивному иммунитету, полученному трансплацентарно). Наибольший показатель отмечается среди детей первых лет жизни, что связано с посещением ими детских учреждений (при этом заболеваемость ОРВИ на протяжении первого года может достигать 10 раз/год). Снижение заболеваемости в более старших возрастных группах объясняется приобретением специфического иммунитета после перенесённого заболевания. В среднем на протяжении года каждый взрослый переносит ОРВИ не реже 2—3 раз. Удельный вес конкретных заболеваний в общей структуре ОРВИ зависит от эпидемической обстановки и возраста пациентов. Известны случаи, когда клинические проявления заболевания минимальны, а симптомы инфекционного токсикоза отсутствуют — такие пациенты переносят ОРВИ «на ногах», являясь источником заражения детей и пожилых людей. В настоящее время достоверно установлена вирусная природа практически для всех так называемых простудных заболеваний[1].

    Источник инфекции

    Источником ОРВИ является больной человек или в некоторых случаях зверь или птица, которые представляют опасность с момента окончания инкубационного периода до окончания лихорадочного периода.

    Передача инфекции

    Практически вся группа ОРВИ передаётся в основном воздушно-капельным (вдыхание аэрозоля, образуемого при кашле или чихании), а также оральным путём (поцелуи, а также рукопожатие или прикосновение к заражённым поверхностям с последующим заносом в рот). Иногда передача возбудителя инфекции возможна через предметы обихода, игрушки, бельё или посуду[1].

    Восприимчивость

    Восприимчивость к заболеванию всеобщая и высокая. Относительно маловосприимчивы дети первых месяцев жизни, рождённые от матерей с циркулирующими антителами к возбудителям ОРВИ. При отсутствии у матери защитных антител к ОРВИ восприимчивы даже новорождённые. После перенесенной инфекции, как правило, формируется стойкий специфический пожизненный иммунитет. Повторное заболевание может быть вызвано заражением другим пневмотропным вирусом (вызывающим ОРВИ)[1].

    Этиология

    ОРВИ вызывается разнообразными возбудителями, среди которых вирусы парагриппа, аденовирусы, риновирусы, реовирусы и др. — всего более 300 подтипов. Все они весьма заразны, так как передаются воздушно-капельным путём. Есть данные, что вирусы ОРВИ эффективно распространяются и при телесном контакте, например, при рукопожатии.

    Патогенез

    В начальный период болезни вирус размножается во входных «воротах инфекции»: носу, носоглотке, гортани, что проявляется в виде рези, насморка, першения, сухого кашля. Температура обычно не повышается. Иногда в этот процесс вовлекаются слизистые глаз и желудочно-кишечного тракта.

    Затем вирус попадает в кровь и вызывает симптомы общей интоксикации: озноб, головная боль, ломота в спине и конечностях. Активация иммунного ответа приводит к выработке организмом антител к вирусу, вследствие чего кровь постепенно очищается от него, и симптомы интоксикации ослабевают.

    На финальном этапе неосложнённой ОРВИ происходит очищение дыхательных путей от поражённых вирусом слоёв эпителия, что проявляется как насморк и влажный кашель с отхождением слизистой или гнойной мокроты.

    Клиническая картина

    Продолжительность симптомов простуды

    Основные симптомы ОРВИ — насморк, кашель, чиханье, головная боль, боль в горле, глазных яблоках, слабость.

    Дифференциальный диагноз

    Ввиду широкой распространённости и неоднородности различных острых респираторных инфекций часто возникает необходимость проведения дифференциального диагноза в целях установления точной причины болезни. Знание принципов дифференциальной диагностики различных ОРВИ необходимо для предупреждения различных осложнений и коррекции тактики лечения больного.
    Наиболее частыми возбудителями ОРВИ являются парагрипп (более лёгкое, чем у гриппа, течение, поражение гортани с риском удушения у детей), аденовирусная инфекция (менее выраженное, чем у гриппа, начало, ангина и лимфаденопатия, поражение конъюнктивы глаз, сильный насморк, возможно поражение печени), инфекция респираторно-синцитиальным вирусом (поражение бронхов и бронхиол, возможность развития бронхопневмонии, более лёгкое и длительное, чем у гриппа, течение)[3].

    Симптомы диспепсии (рвота, разжижение стула) должны насторожить в плане ротавирусной инфекции.

    При выраженном воспалении миндалин (особенно частом при аденовирусной инфекции) необходимо исключить ангину и инфекционный мононуклеоз.

    Сильно выраженная лихорадка может вызвать подозрения на корь, скарлатину и т. п.

    Из более экзотических заболеваний, первые симптомы которых могут напоминать ОРВИ, следует отметить гепатиты, СПИД и т. д., поэтому, если симптомам ОРВИ в предыдущие несколько недель предшествовали события, опасные в плане заражения этими болезнями (контакт с больным гепатитом A, незащищённый половой контакт со случайным партнёром, внутривенные инъекции в нестерильных условиях), следует немедленно обратиться к врачу.

    Лечение

    Регулярное употребление витамина C не снижает шансы заболевания ОРВИ в целом по популяции, однако в ряде случаев позволяет уменьшить тяжесть и длительность заболевания (от 3 % до 12 % у взрослых), особенно у пациентов, подверженных сильным физическим нагрузкам[4]. Против большинства возбудителей ОРВИ в настоящее время не разработаны химиопрепараты, и своевременная дифференциальная диагностика затруднена.

    ОРВИ вызывается вирусами, против которых антибиотики бесполезны[5]. Из жаропонижающих средств применяют нестероидные противовоспалительные средства, в их числе парацетамол, а в последнее время — ибупрофен[6][7].

    На текущий день существует только симптоматическое лечение. Многие люди используют нерецептурные препараты, которые содержат антигистаминные средства, противоотёчные, анальгетики или их комбинацию в качестве самостоятельного лечения простуды. Обзор 27 исследований с более чем 5000 участников показывает некоторую пользу в отношении общего восстановления и устранения симптомов. Сочетание антигистаминных и противоотёчных средств является наиболее эффективным, но многие люди испытывают побочные эффекты, такие как сонливость, сухость во рту, бессонница и головокружение. Нет никаких доказательств положительного эффекта у детей раннего возраста. Включённые испытания изучали очень разные популяции, процедуры и результаты, но в целом методологическое качество было приемлемым[источник не указан 626 дней]. Не существует противовирусных средств, эффективных при простуде (назофарингите вирусной природы)[8].

    Осложнения

    К осложнениям относятся: бактериальные риниты, синуситы, отиты, трахеиты, тонзиллиты, пневмония, менингит, неврит, радикулоневрит.

    Профилактика

    В разгар инфекции рекомендуется ограничить посещение массовых мероприятий, особенно в закрытых помещениях, избегать слишком тесного контакта с больными, как можно чаще мыть руки. Те же правила следует соблюдать и заболевшим: взять больничный лист, стремиться как можно меньше пользоваться общественным транспортом, избегать тесного контакта со здоровыми людьми, носить марлевую повязку.

    «Мужской грипп»

    Диагноз «Острая инфекция верхних дыхательных путей» ставится мужчинам на 10 % чаще, чем женщинам[источник не указан 626 дней]. Возникло понятие мужской грипп. Это выражение означает, что многие мужчины, страдая ОРВИ, но не гриппом, преувеличивают тяжесть заболевания и заявляют, что у них грипп[9][10].

    См. также

    Примечания

    Литература

    • Дрейзин Р. С., Астафьева Н. В. Острые респираторные заболевания: Этиология, эпидемиология, патогенез, клиника / Р. С. Дрейзин, Н. В. Астафьева. — М.: Медицина, 1991. — 136 с. — (Библиотека практического врача. Инфекционные и паразитарные заболевания). — 20 000 экз. — ISBN 5-225-00398-2.
    • Михайлов А. А., Дворецкий Л. И., ред. Справочник практического врача. Эксмо, 2007. 528 с. ISBN 9785699234301, ISBN 9785699234301, ISBN 9785699234301, ISBN 9785699234301. 1-е издание: Справочник практического врача под ред. Воробьева А. И. М., Медицина, 1981. 656 с.

    Ссылки

    Острая респираторная вирусная инфекция — Википедия. Что такое Острая респираторная вирусная инфекция

    О́страя респирато́рная ви́русная инфе́кция (ОРВИ) — группа клинически и морфологически подобных острых воспалительных заболеваний органов дыхания, возбудителями которых являются пневмотропные вирусы. ОРВИ — самая распространённая в мире группа заболеваний, объединяющая респираторно-синцитиальную инфекцию, риновирусную и аденовирусную инфекции и другие катаральные воспаления верхних дыхательных путей[1][2]. В процессе развития вирусное заболевание может осложняться бактериальной инфекцией.

    Эпидемиология

    ОРВИ встречаются повсеместно и являются самым распространённым инфекционным заболеванием, поэтому полностью учесть заболеваемость невозможно. Дети первых месяцев жизни практически не болеют (благодаря относительной изоляции и пассивному иммунитету, полученному трансплацентарно). Наибольший показатель отмечается среди детей первых лет жизни, что связано с посещением ими детских учреждений (при этом заболеваемость ОРВИ на протяжении первого года может достигать 10 раз/год). Снижение заболеваемости в более старших возрастных группах объясняется приобретением специфического иммунитета после перенесённого заболевания. В среднем на протяжении года каждый взрослый переносит ОРВИ не реже 2—3 раз. Удельный вес конкретных заболеваний в общей структуре ОРВИ зависит от эпидемической обстановки и возраста пациентов. Известны случаи, когда клинические проявления заболевания минимальны, а симптомы инфекционного токсикоза отсутствуют — такие пациенты переносят ОРВИ «на ногах», являясь источником заражения детей и пожилых людей. В настоящее время достоверно установлена вирусная природа практически для всех так называемых простудных заболеваний[1].

    Источник инфекции

    Источником ОРВИ является больной человек или в некоторых случаях зверь или птица, которые представляют опасность с момента окончания инкубационного периода до окончания лихорадочного периода.

    Передача инфекции

    Практически вся группа ОРВИ передаётся в основном воздушно-капельным (вдыхание аэрозоля, образуемого при кашле или чихании), а также оральным путём (поцелуи, а также рукопожатие или прикосновение к заражённым поверхностям с последующим заносом в рот). Иногда передача возбудителя инфекции возможна через предметы обихода, игрушки, бельё или посуду[1].

    Восприимчивость

    Восприимчивость к заболеванию всеобщая и высокая. Относительно маловосприимчивы дети первых месяцев жизни, рождённые от матерей с циркулирующими антителами к возбудителям ОРВИ. При отсутствии у матери защитных антител к ОРВИ восприимчивы даже новорождённые. После перенесенной инфекции, как правило, формируется стойкий специфический пожизненный иммунитет. Повторное заболевание может быть вызвано заражением другим пневмотропным вирусом (вызывающим ОРВИ)[1].

    Этиология

    ОРВИ вызывается разнообразными возбудителями, среди которых вирусы парагриппа, аденовирусы, риновирусы, реовирусы и др. — всего более 300 подтипов. Все они весьма заразны, так как передаются воздушно-капельным путём. Есть данные, что вирусы ОРВИ эффективно распространяются и при телесном контакте, например, при рукопожатии.

    Патогенез

    В начальный период болезни вирус размножается во входных «воротах инфекции»: носу, носоглотке, гортани, что проявляется в виде рези, насморка, першения, сухого кашля. Температура обычно не повышается. Иногда в этот процесс вовлекаются слизистые глаз и желудочно-кишечного тракта.

    Затем вирус попадает в кровь и вызывает симптомы общей интоксикации: озноб, головная боль, ломота в спине и конечностях. Активация иммунного ответа приводит к выработке организмом антител к вирусу, вследствие чего кровь постепенно очищается от него, и симптомы интоксикации ослабевают.

    На финальном этапе неосложнённой ОРВИ происходит очищение дыхательных путей от поражённых вирусом слоёв эпителия, что проявляется как насморк и влажный кашель с отхождением слизистой или гнойной мокроты.

    Клиническая картина

    Продолжительность симптомов простуды

    Основные симптомы ОРВИ — насморк, кашель, чиханье, головная боль, боль в горле, глазных яблоках, слабость.

    Дифференциальный диагноз

    Ввиду широкой распространённости и неоднородности различных острых респираторных инфекций часто возникает необходимость проведения дифференциального диагноза в целях установления точной причины болезни. Знание принципов дифференциальной диагностики различных ОРВИ необходимо для предупреждения различных осложнений и коррекции тактики лечения больного.
    Наиболее частыми возбудителями ОРВИ являются парагрипп (более лёгкое, чем у гриппа, течение, поражение гортани с риском удушения у детей), аденовирусная инфекция (менее выраженное, чем у гриппа, начало, ангина и лимфаденопатия, поражение конъюнктивы глаз, сильный насморк, возможно поражение печени), инфекция респираторно-синцитиальным вирусом (поражение бронхов и бронхиол, возможность развития бронхопневмонии, более лёгкое и длительное, чем у гриппа, течение)[3].

    Симптомы диспепсии (рвота, разжижение стула) должны насторожить в плане ротавирусной инфекции.

    При выраженном воспалении миндалин (особенно частом при аденовирусной инфекции) необходимо исключить ангину и инфекционный мононуклеоз.

    Сильно выраженная лихорадка может вызвать подозрения на корь, скарлатину и т. п.

    Из более экзотических заболеваний, первые симптомы которых могут напоминать ОРВИ, следует отметить гепатиты, СПИД и т. д., поэтому, если симптомам ОРВИ в предыдущие несколько недель предшествовали события, опасные в плане заражения этими болезнями (контакт с больным гепатитом A, незащищённый половой контакт со случайным партнёром, внутривенные инъекции в нестерильных условиях), следует немедленно обратиться к врачу.

    Лечение

    Регулярное употребление витамина C не снижает шансы заболевания ОРВИ в целом по популяции, однако в ряде случаев позволяет уменьшить тяжесть и длительность заболевания (от 3 % до 12 % у взрослых), особенно у пациентов, подверженных сильным физическим нагрузкам[4]. Против большинства возбудителей ОРВИ в настоящее время не разработаны химиопрепараты, и своевременная дифференциальная диагностика затруднена.

    ОРВИ вызывается вирусами, против которых антибиотики бесполезны[5]. Из жаропонижающих средств применяют нестероидные противовоспалительные средства, в их числе парацетамол, а в последнее время — ибупрофен[6][7].

    На текущий день существует только симптоматическое лечение. Многие люди используют нерецептурные препараты, которые содержат антигистаминные средства, противоотёчные, анальгетики или их комбинацию в качестве самостоятельного лечения простуды. Обзор 27 исследований с более чем 5000 участников показывает некоторую пользу в отношении общего восстановления и устранения симптомов. Сочетание антигистаминных и противоотёчных средств является наиболее эффективным, но многие люди испытывают побочные эффекты, такие как сонливость, сухость во рту, бессонница и головокружение. Нет никаких доказательств положительного эффекта у детей раннего возраста. Включённые испытания изучали очень разные популяции, процедуры и результаты, но в целом методологическое качество было приемлемым[источник не указан 626 дней]. Не существует противовирусных средств, эффективных при простуде (назофарингите вирусной природы)[8].

    Осложнения

    К осложнениям относятся: бактериальные риниты, синуситы, отиты, трахеиты, тонзиллиты, пневмония, менингит, неврит, радикулоневрит.

    Профилактика

    В разгар инфекции рекомендуется ограничить посещение массовых мероприятий, особенно в закрытых помещениях, избегать слишком тесного контакта с больными, как можно чаще мыть руки. Те же правила следует соблюдать и заболевшим: взять больничный лист, стремиться как можно меньше пользоваться общественным транспортом, избегать тесного контакта со здоровыми людьми, носить марлевую повязку.

    «Мужской грипп»

    Диагноз «Острая инфекция верхних дыхательных путей» ставится мужчинам на 10 % чаще, чем женщинам[источник не указан 626 дней]. Возникло понятие мужской грипп. Это выражение означает, что многие мужчины, страдая ОРВИ, но не гриппом, преувеличивают тяжесть заболевания и заявляют, что у них грипп[9][10].

    См. также

    Примечания

    Литература

    • Дрейзин Р. С., Астафьева Н. В. Острые респираторные заболевания: Этиология, эпидемиология, патогенез, клиника / Р. С. Дрейзин, Н. В. Астафьева. — М.: Медицина, 1991. — 136 с. — (Библиотека практического врача. Инфекционные и паразитарные заболевания). — 20 000 экз. — ISBN 5-225-00398-2.
    • Михайлов А. А., Дворецкий Л. И., ред. Справочник практического врача. Эксмо, 2007. 528 с. ISBN 9785699234301, ISBN 9785699234301, ISBN 9785699234301, ISBN 9785699234301. 1-е издание: Справочник практического врача под ред. Воробьева А. И. М., Медицина, 1981. 656 с.

    Ссылки

    Причины, симптомы, типы и многое другое

    Мы включаем продукты, которые, по нашему мнению, будут полезны нашим читателям. Если вы покупаете по ссылкам на этой странице, мы можем заработать небольшую комиссию. Вот наш процесс.

    Каждый, кто когда-либо болел простудой, знает об острых респираторных инфекциях (URI). Острый URI — это заразная инфекция верхних дыхательных путей. Верхние дыхательные пути включают нос, горло, глотку, гортань и бронхи.

    Без сомнения, простуда — самый известный URI.Другие типы URI включают синусит, фарингит, эпиглоттит и трахеобронхит. С другой стороны, грипп — это не URI, потому что это системное заболевание.

    И вирусы, и бактерии могут вызывать острые URI:

    Вирусы

    Бактерии

    • Бета-гемолитические стрептококки группы A
    • Бета-гемолитические стрептококки группы C
    • Corynebacterium diphtheriae (дифтерия)
    • Nerishoeria

    • gonorrhea)
    • Chlamydia pneumoniae (хламидиоз)

    Типы URI относятся к участкам верхних дыхательных путей, наиболее вовлеченным в инфекцию.Помимо простуды, существуют и другие типы ИВД:

    Синусит

    Синусит — воспаление носовых пазух.

    Эпиглоттит

    Эпиглоттит — это воспаление надгортанника, верхней части трахеи. Он защищает дыхательные пути от инородных частиц, которые могут попасть в легкие. Отек надгортанника опасен тем, что может блокировать поступление воздуха в трахею.

    Ларингит

    Ларингит — это воспаление гортани или голосового аппарата.

    Бронхит

    Воспаление бронхов — бронхит. Правый и левый бронхи отходят от трахеи и переходят в правое и левое легкие.

    Простуда — самая частая причина посещения врача в США. URI передаются от человека к человеку через капли аэрозоля и прямой контакт из рук в руки. Риск возрастает в следующих ситуациях:

    • Когда больной чихает или кашляет, не прикрывая нос и рот, в воздух разбрызгиваются капли, содержащие вирусы.
    • Когда люди находятся в закрытом помещении или в тесноте. Люди, находящиеся в больницах, учреждениях, школах и детских садах, подвергаются повышенному риску из-за тесного контакта.
    • При прикосновении к носу или глазам. Заражение происходит при попадании инфицированных выделений в нос или глаза. Вирусы могут жить на объектах, например дверных ручках.
    • Осенью и зимой (с сентября по март), когда люди чаще всего находятся внутри.
    • При низкой влажности.Отопление помещений способствует выживанию многих вирусов, вызывающих URI.
    • Если у вас ослабленная иммунная система.

    Насморк, заложенность носа, чихание, кашель и выделение слизи являются отличительными симптомами URI. Симптомы вызваны воспалением слизистых оболочек верхних дыхательных путей. Другие симптомы включают:

    Большинство людей с URI знают, что у них есть. Они могут посетить своего врача для облегчения симптомов. Большинство URI диагностируются путем изучения истории болезни человека и его физического осмотра.Для диагностики URI можно использовать следующие тесты:

    • Мазок из горла: быстрое определение антигена может использоваться для быстрой диагностики бета-гемолитической стрептококковой инфекции группы А.
    • Боковой рентген шеи: этот тест может быть назначен для исключения эпиглоттита, если у вас затрудненное дыхание.
    • Рентген грудной клетки: Ваш врач может назначить этот анализ, если подозревает пневмонию.
    • КТ: этот тест может использоваться для диагностики синусита.

    URI в основном лечат для облегчения симптомов.Некоторым людям полезно употреблять средства от кашля, отхаркивающие средства, витамин С и цинк, чтобы уменьшить симптомы или сократить продолжительность. Другие методы лечения включают следующее:

    • Назальные деконгестанты могут улучшить дыхание. Но лечение может быть менее эффективным при повторном использовании и может вызвать возвратную заложенность носа.
    • Вдыхание пара и полоскание соленой водой — безопасный способ облегчить симптомы ИВДП.
    • Анальгетики, такие как ацетаминофен и НПВП, могут помочь снизить температуру, боли и боли.

    Интернет-магазин средств для подавления кашля, отхаркивающих средств, витамина С, цинка и паровых ингаляторов.

    Лучшая защита от URI — частое мытье рук водой с мылом. Мытье рук снижает выделение секретов, которые могут распространять инфекцию. Вот еще несколько стратегий:

    • Избегайте тесного контакта с больными людьми.
    • Протрите такие предметы, как пульты дистанционного управления, телефоны и дверные ручки, к которым могут прикоснуться люди в доме, у которых есть URI.
    • Прикройте рот и нос, если заболели вы.
    • Оставайтесь дома, если заболели.

    Список типов и заразность, лечение, профилактика

    Определение вирусного заболевания

    Вирусы — это очень маленькие инфекционные агенты. Они состоят из части генетического материала, такого как ДНК или РНК, который заключен в белковый слой.

    Вирусы проникают в клетки вашего тела и используют компоненты этих клеток, чтобы помочь им размножаться. Этот процесс часто повреждает или уничтожает инфицированные клетки.

    Вирусное заболевание — это любое заболевание или состояние здоровья, вызванное вирусом. Читайте дальше, чтобы узнать больше о некоторых основных типах вирусных заболеваний:

    Не все вирусные заболевания заразны. Это означает, что они не всегда передаются от человека к человеку. Но многие из них. Общие примеры заразных вирусных заболеваний включают грипп, простуду, ВИЧ и герпес.

    Другие типы вирусных болезней передаются другими способами, например, через укус инфицированного насекомого.

    Респираторно-вирусные заболевания заразны и обычно поражают верхние или нижние отделы дыхательных путей.

    Общие симптомы респираторного вирусного заболевания включают:

    • насморк или заложенность носа
    • кашель или чихание
    • лихорадку
    • боли в теле

    Примеры

    Примеры респираторных заболеваний включают:

    Передача

    Респираторные вирусы: распространяется воздушно-капельным путем при кашле или чихании. Если поблизости кто-то с вирусным заболеванием кашляет или чихает, а вы вдыхаете эти капли, у вас может развиться болезнь.

    Эти вирусы также могут распространяться через зараженные предметы, такие как дверные ручки, столешницы и личные вещи. Если вы дотронетесь до одного из этих предметов, а затем коснетесь своего носа или глаз, у вас может развиться болезнь.

    Лечение

    Респираторные вирусные заболевания обычно проходят самостоятельно. Но лекарства, отпускаемые без рецепта, в том числе назальные деконгестанты, средства от кашля и болеутоляющие средства, могут помочь уменьшить симптомы.

    Кроме того, Тамифлю, противовирусный препарат, иногда назначают тем, кто находится на очень ранних стадиях развития гриппа.

    Профилактика

    Лучший способ избежать респираторных вирусных заболеваний — это соблюдение правил личной гигиены. Часто мойте руки, прикрывайте рот, когда кашляете или чихаете, и ограничивайте свое общение с людьми, у которых наблюдаются симптомы респираторного заболевания.

    Существует также вакцина, которая может помочь снизить риск заражения сезонным гриппом.

    Вирусные заболевания желудочно-кишечного тракта влияют на ваш пищеварительный тракт. Вызывающие их вирусы заразны и обычно вызывают состояние, называемое гастроэнтеритом, также называемым желудочным гриппом.

    Общие симптомы желудочно-кишечных вирусных заболеваний включают:

    • спазмы в животе
    • диарея
    • рвота

    Примеры

    Примеры желудочно-кишечных вирусных заболеваний включают:

    Передача

    Желудочно-кишечные вирусы выделяются в кишечнике во время дефекации. Пища или вода, загрязненные фекалиями, могут передавать вирус другим. Вы также можете заразиться вирусом, поделившись посудой или личными вещами с кем-то, у кого есть вирус.

    Лечение

    Лечения желудочно-кишечных вирусных заболеваний не существует. Во многих случаях они проходят самостоятельно в течение дня или двух. А пока пейте много жидкости, чтобы восполнить потерю жидкости от диареи или рвоты.

    Профилактика

    Вы можете предотвратить вирусные заболевания желудочно-кишечного тракта, часто мыть руки, особенно после посещения туалета. Также может помочь протирание загрязненных поверхностей и отказ от использования личных вещей или столовых приборов.

    Существует также вакцина против ротавируса, которая рекомендуется как часть календаря вакцинации ребенка.

    Экзантематозные вирусы вызывают кожную сыпь. Многие из них также вызывают дополнительные симптомы.

    Многие вирусы этой категории, например вирус кори, очень заразны.

    Примеры

    Примеры экзантематозных вирусных заболеваний включают:

    Передача

    Многие экзантематозные вирусы передаются воздушно-капельным путем при кашле или чихании человека, инфицированного вирусом.

    Другие экзантематозные вирусные заболевания, такие как ветряная оспа и оспа, могут передаваться при контакте с жидкостью в поврежденных участках кожи.

    Опоясывающий лишай встречается только у людей, которые в какой-то момент переболели ветряной оспой. Это реактивация вируса ветряной оспы, который бездействовал в ваших клетках.

    Вирус чикунгунья передается через укус комара и не может передаваться от человека к человеку.

    Лечение

    Лечение экзантематозных вирусных заболеваний направлено на устранение симптомов.Лекарства для снижения температуры, такие как ацетаминофен, могут помочь с некоторыми из наиболее неприятных симптомов.

    Противовирусные препараты, такие как ацикловир, можно назначать от ветряной оспы или опоясывающего лишая.

    Профилактика

    Корь, краснуху, ветряную оспу, опоясывающий лишай и оспу можно предотвратить с помощью вакцинации. Вы можете снизить риск заражения вирусом чикунгунья, защитив себя от укусов комаров.

    Узнайте больше о вирусных высыпаниях.

    Вирусные заболевания печени вызывают воспаление печени, известное как вирусный гепатит.Наиболее распространенными типами вирусных гепатитов являются гепатиты A, B и C.

    Следует отметить, что заболевания, вызываемые другими вирусами, такими как цитомегаловирус и вирус желтой лихорадки, также могут поражать печень.

    Примеры

    Примеры вирусных заболеваний печени включают:

    Гепатиты B и C могут передаваться от человека к человеку через жидкости организма. Совместное использование предметов, контактирующих с кровью, таких как иглы или бритвы, также может распространять вирус. Гепатит В может передаваться половым путем.

    Люди заражаются гепатитом А и Е в результате употребления пищи или воды, загрязненных фекалиями инфицированного человека.

    У вас может развиться гепатит D, только если у вас уже есть вирус гепатита B.

    Лечение

    Лечение гепатита B, C и D направлено на устранение симптомов. В некоторых случаях врач может прописать лекарства, например, противовирусные препараты.

    Лечение гепатитов А и Е включает поддерживающие меры, такие как много отдыха, питье и отказ от алкоголя.

    Профилактика

    Существуют вакцины как от гепатита А, так и от гепатита В. Есть также вакцина от гепатита Е, но она недоступна в США.

    Другие способы предотвращения вирусного гепатита включают отказ от совместного использования игл или бритв, безопасный секс, и отказ от еды и напитков, которые могут быть загрязнены фекалиями.

    Кожные вирусные заболевания вызывают образование на коже высыпаний или папул. Во многих случаях эти поражения могут сохраняться надолго или возвращаться через некоторое время после исчезновения.

    Примеры

    Примеры кожных вирусных заболеваний включают:

    Эти вирусы заразны. Обычно они передаются при тесном физическом контакте с кем-то, кто заражен вирусом, или при прикосновении к зараженному предмету, например, полотенцу или ручке крана.

    Лечение

    Папулы, образующиеся из-за бородавок или контагиозного моллюска, часто проходят сами по себе. Их также можно удалить с помощью простых процедур в офисе, таких как криотерапия.

    Лекарства от герпеса нет, но противовирусные препараты, такие как ацикловир, могут помочь сократить или предотвратить вспышки.

    Профилактика

    Соблюдение правил гигиены, отказ от совместного использования личных вещей и избегание тесного контакта с людьми с активными поражениями может снизить риск развития кожного вирусного заболевания.

    Геморрагические вирусные заболевания — это тяжелые заболевания, которые вызывают повреждение вашей системы кровообращения.

    Симптомы геморрагического вирусного заболевания включают:

    • высокая температура
    • боли в теле
    • слабость
    • кровотечение под кожей
    • кровотечение изо рта или ушей
    • кровотечение во внутренних органах

    Примеры

    Примеры К вирусным геморрагическим заболеваниям относятся:

    Передача

    Некоторые геморрагические вирусные заболевания, такие как лихорадка денге и желтая лихорадка, передаются через укусы инфицированного насекомого.

    Другие люди, такие как Эбола, передаются другим людям через контакт с кровью или другими жидкостями организма человека, инфицированного вирусом. Лихорадка Ласса распространяется через вдыхание или употребление высушенных фекалий или мочи грызунов, инфицированных вирусом.

    Лечение

    Специального лечения геморрагических вирусных заболеваний не существует.

    Очень важно избегать обезвоживания, если у вас вирусная геморрагическая болезнь. Некоторым людям может потребоваться внутривенное (IV) введение жидкости для поддержания электролитного баланса.Поддерживающая терапия для поддержания гидратации и электролитного баланса имеет важное значение. В некоторых случаях может быть назначен противовирусный препарат рибавирин.

    Профилактика

    Исследователи разрабатывают вакцины против нескольких геморрагических вирусов. Вакцина против желтой лихорадки в настоящее время доступна для людей, путешествующих в районы, где желтая лихорадка распространена.

    Если вы живете или работаете в районе, где распространены вирусные геморрагические заболевания, вы можете сделать следующее, чтобы снизить риск:

    • Используйте надлежащую защиту, например перчатки, очки или маску для лица, когда работаете с людьми, которые есть вирус.
    • Избегайте укусов насекомых, особенно комаров и клещей, надев защитную одежду или пользуясь репеллентом от насекомых.
    • Защитите себя от заражения грызунами, накрывая продукты, часто убирая мусор и проверяя, что окна и двери надежно закреплены.

    Некоторые вирусы могут поражать мозг и окружающие ткани, вызывая неврологические вирусные заболевания. Это может привести к ряду симптомов, в том числе:

    • лихорадка
    • спутанность сознания
    • сонливость
    • судороги
    • проблемы координации

    Примеры

    Примеры неврологических вирусных заболеваний включают:

    Многие неврологические вирусы распространяются через укус инфицированного животного или насекомого, например комара или клеща.

    Другие вирусы, такие как полиовирус и другие энтеровирусы, довольно заразны и распространяются при тесном контакте с кем-то, кто инфицирован этим вирусом. Зараженные объекты также могут способствовать распространению этих вирусов.

    Лечение

    Специального лечения для людей с легким вирусным менингитом или энцефалитом не существует. Хороший отдых, потребление жидкости и прием безрецептурных противовоспалительных средств для облегчения боли или головной боли — все это может помочь. В некоторых случаях могут быть назначены противовирусные препараты.

    Полиомиелит или тяжелые случаи менингита или энцефалита могут потребовать дополнительного лечения, например, помощи при дыхании или внутривенного введения жидкостей.

    Если животное, подозреваемое в вирусе бешенства, укусит вас, вам сделают серию уколов, чтобы предотвратить заражение вирусом бешенства.

    Профилактика

    Существует вакцина как от полиовируса, так и от вируса паротита, которые могут вызывать менингит и энцефалит.

    Соблюдение правил гигиены, избегание тесного контакта с инфицированными и защита от укусов насекомых — все это может помочь снизить распространение энцефалита и менингита.

    Чтобы снизить риск распространения бешенства, держите своих питомцев вакцинированными и не приближайтесь к диким животным.

    Есть много вирусных заболеваний. Некоторые из них, такие как простуда или желудочный грипп, протекают легко и проходят сами по себе в течение нескольких дней. Другие, однако, более серьезны.

    В отличие от бактериальных инфекций, вирусные заболевания не поддаются лечению антибиотиками. Вместо этого лечение обычно направлено на устранение симптомов и поддержку иммунной системы с помощью достаточного количества отдыха и гидратации.

    Респираторные вирусные инфекции | Мемориальный онкологический центр им. Слоуна-Кеттеринга

    Перейти к основному содержанию

    Мемориальный онкологический центр им. Слоуна Кеттеринга

    • Институт Слоана Кеттеринга

    • Давать

    • Локации

    • Врачи

    • Назначения

    • Связаться с нами

    Поиск
    Закрыть поиск

    Меню
    Закрыть меню

    • Взрослые пациенты

      • Обзор взрослых пациентов
        • Онкологическая помощь
        • Типы рака
        • Оценка и скрининг рисков
        • Диагностика и лечение
        • Клинические испытания
        • Ваш опыт
        • Стать пациентом
        • Поддержка пациентов
        • Поддержка опекунов
        • Наши офисы
        • Нью-Джерси
        • Нью-Йорк
        • Штат Нью-Йорк
        • Страхование и помощь
        • Информация о страховании
        • Финансовая помощь
      • Найти врачаЗаписаться на прием Информация для посетителейMyMSK
    • Пациенты-дети и подростки

      • Обзор пациентов-детей и подростков
        • Детское онкологическое лечение
        • Наше лечение в MSK Kids
        • Детское онкологическое лечение
        • Лечение
        • Педиатрические клинические испытания
        • Ваш опыт
        • Послушайте наши пациенты
        • Стать пациентом
        • Жизнь в MSK Дети
        • Приход в MSK Kids
        • Стационарное лечение
        • Амбулаторное лечение
        • Размещение
        • Страхование и помощь
        • Информация о страховании
        • Финансовая помощь
      • Найти врачаЗаписаться на прием16 Информация для посетителейFAQ 900
    • Медицинские работники

      • Обзор специалистов здравоохранения
        • Клинические ресурсы
        • Направление пациента
        • Отношения с врачом
        • Клинические испытания
        • Клинические обновления и аналитика
        • Инструменты прогнозирования
        • Образование и обучение
        • Продолжение медицинского образования
        • Стипендии
        • Резиденции
        • Возможности для студентов-медиков
        • Департаменты и подразделения
        • Анестезиология и реаниматология
        • Лабораторная медицина
        • Медицинская физика
        • Медицина
        • Неврология
        • Нейрохирургия
      • Сестринское дело
      • Патология
      • Психиатрия и поведенческие науки
      • Лучевая онкология
      • Радиология
      • Хирургия
    • Найти врача Направить пациентаНовостную рассылку Подписка

    Дыхательные пути инфекции (ИРО) — NHS

    Инфекции дыхательных путей (ИРО) могут поражать носовые пазухи, горло, дыхательные пути или легкие.Большинство ИРТ проходят без лечения, но иногда вам может потребоваться посещение терапевта.

    Проверьте, есть ли у вас ИРО.

    Симптомы ИРО включают:

    • кашель — вы можете вызвать слизь (мокроту)
    • чихание
    • заложенный или насморк
    • боль в горле
    • головные боли
    • мышцы боли
    • одышка, сжатие в груди или хрипы
    • высокая температура (жар)
    • общее недомогание

    Что вы можете сделать самостоятельно

    Большинство ИРТ проходят в течение 1-2 недель.Обычно вы можете лечить свои симптомы дома.

    Делать

    • отдохни

    • Пейте много воды, чтобы разжижить слизь и облегчить кашель

    • Выпейте горячий напиток с лимоном и медом, чтобы успокоить кашель (не подходит для младенцев)

    • полоскать горло теплой соленой водой, если у вас болит горло (детям не следует пробовать это)

    • поднимайте голову во время сна, используя дополнительные подушки, чтобы облегчить дыхание и очистить грудь от слизи

    • использовать обезболивающие для снижения температуры и облегчения боли в горле, головных и мышечных болей

    Не

    • не позволяйте детям вдыхать пар из чаши с горячей водой, так как есть риск ошпаривания

    • Не давайте аспирин детям до 16 лет

    • не курите — это может ухудшить ваши симптомы

    Как приготовить горячий напиток с лимоном и медом

    1. Выдавить половину лимона в кружку с кипяченой водой.
    2. Добавить 1-2 чайные ложки меда.
    3. Пить еще теплым.

    Не давайте горячие напитки маленьким детям.

    Как полоскать горло соленой водой

    1. Растворите половину чайной ложки соли в стакане теплой воды — теплая вода помогает растворить соль
    2. Полощите раствор, затем выплюньте его — не глотайте
    3. Повторяйте столько раз, сколько хотите

    Фармацевт может помочь с RTI

    Фармацевт может предложить лечение, которое поможет облегчить ваши симптомы, например, противоотечные средства и спреи для носа.

    Вы также можете купить лекарства от кашля и леденцы от горла, хотя доказательств их эффективности мало.

    Некоторые препараты содержат парацетамол и ибупрофен.

    Если вы принимаете эти лекарства отдельно, будьте осторожны и не принимайте больше рекомендованной дозы.

    Некоторые виды лечения не подходят детям, младенцам и беременным женщинам. Ваш фармацевт может посоветовать вам лучшее лечение для вас или вашего ребенка.

    Информация:

    Позвоните в аптеку или свяжитесь с ними через Интернет, прежде чем идти лично. Вы можете заказать доставку лекарств или попросить кого-нибудь забрать их.

    Несрочный совет: обратитесь к терапевту, если:

    • вы чувствуете себя очень плохо или симптомы ухудшаются
    • вы кашляете кровью или окровавленной слизью
    • вы кашляете более 3 недель
    • вы беременны
    • вы старше 65
    • у вас ослабленная иммунная система — например, из-за того, что у вас диабет или вы проходите химиотерапию
    • у вас есть хроническое заболевание, такое как болезнь сердца, легких или почек

    У вас может быть пневмония, если ваши симптомы суровы.

    Информация:

    Обновление коронавируса: как связаться с GP

    По-прежнему важно получить помощь от терапевта, если она вам нужна. Чтобы связаться с вашим терапевтом:

    • посетите их веб-сайт
    • используйте приложение NHS
    • позвоните им

    Узнайте об использовании NHS во время коронавируса

    Лечение у вашего терапевта

    Лечение будет зависеть от причины вашего ИРТ:

    • вирус (например, простуда) — обычно это проходит само по себе через несколько недель, и антибиотики не помогают
    • бактерии ( например, пневмония) — ваш терапевт может назначить антибиотики (убедитесь, что вы прошли весь курс в соответствии с рекомендациями терапевта, даже если вы почувствуете себя лучше)

    Иногда может потребоваться анализ образца слизи, чтобы выяснить, что вызывает у вас РТИ.

    Использование антибиотиков

    Антибиотики используются только для лечения бактериальных инфекций. Они не используются для лечения вирусных инфекций, потому что не работают с этим типом инфекции.

    Как избежать передачи ИРО другим:

    • Прикрывайте рот, когда кашляете или чихаете
    • Регулярно мойте руки
    • Немедленно выбрасывайте использованные салфетки

    Как избежать заражения ИРО

    Если вы продолжаете получать ИРО или вы подвержены высокому риску заразиться им (например, потому что вам больше 65 лет или вы страдаете серьезным хроническим заболеванием), вам следует:

    Причины и типы ИРО

    ИРО часто бывают распространяется при кашле и чихании инфицированного человека.

    Есть несколько разных типов. Обычно их разделяют на верхние и нижние ИРТ.

    Грипп может быть верхним или нижним ИРТ.

    Более низкие ИРТ, как правило, длятся дольше и могут быть более серьезными.

    Последняя проверка страницы: 12 апреля 2018 г.
    Срок следующей проверки: 12 апреля 2021 г.

    Респираторно-синцитиальный вирус, метапневмовирус человека и вирусная инфекция гриппа в Бангкоке, 2016–2017 гг. [PeerJ]

    Введение

    Инфекция дыхательных путей является основным фактором заболеваемости и смертности среди детей и взрослых во всем мире (Boloursaz et al., 2013; Гарг и др., 2015). Наиболее широко известна инфекция, вызываемая вирусом сезонного гриппа, от которого ежегодно умирает от 290 000 до 650 000 человек (ВОЗ, 2018). Эпидемиологические исследования показали, что младенцы, маленькие дети и пожилые люди особенно подвержены риску заражения обоими подтипами RSV (обозначенными A и B) (Henrickson et al., 2004). Даже hMPV теперь признан частой причиной острых респираторных инфекций у детей, преимущественно в возрасте до 5 лет, пожилых людей и пациентов с ослабленным иммунитетом (Johnstone et al., 2008; Williams et al., 2004). Каждую из двух генетически и антигенно различных групп hMPV (A и B) можно далее разделить на генетические подгруппы 1 и 2 (Boivin et al., 2002).

    Множественные группы различных респираторных вирусов часто циркулируют совместно с различным типом преобладания в Таиланде. Данные о распространенности инфекции, вызванной этими вирусами, часто неполны и ограничены из-за их сходной клинической картины и сезонного совпадения (Thanasugarn et al., 2003; Horthongkham et al., 2014). Систематическое использование молекулярной диагностики, такой как анализ полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) в реальном времени, имело важное значение для улучшения точной диагностики респираторных вирусных инфекций и оказалось чрезвычайно полезным для наблюдения за заболеваниями (Mahony, 2008).

    Здесь мы стремились оценить бремя болезней, вызванных RSV, hMPV и вирусом гриппа, у большого количества пациентов всех возрастов, которые проявили гриппоподобное заболевание (ГПЗ) и обратились за медицинской помощью в больницу в Бангкоке в течение последних двух лет. .

    Материалы и методы

    Дизайн исследования и образцы

    Мы ретроспективно протестировали 8 842 сохраненных респираторных образца, полученных как у стационарных, так и у амбулаторных пациентов с ГПЗ, обращавшихся за медицинской помощью в Международную больницу Бангпакок 9 в Бангкоке, и взятых последовательно в период с января 2016 года по декабрь 2017 года. ГПЗ был определен как лихорадка. (> 38 ° C) и сопутствующие респираторные симптомы, такие как кашель, боль в горле или фарингит.В этом исследовании были проанализированы обезличенные удобные образцы и расширено более раннее расследование продолжающейся распространенности вируса гриппа в Таиланде (Suntronwong et al., 2017). Доступная информация о пациентах включала пол и возраст, но не включала обширную клиническую информацию или тяжесть заболевания. Экспертный совет медицинского факультета Чулалонгкорнского университета одобрил это исследование (номер IRB 609/59).

    ОТ-ПЦР в реальном времени

    РНК

    экстрагировали из 200 мкл образцов с помощью набора для экстракции вирусных нуклеиновых кислот (RBC Bioscience, Тайвань, Р.O.C.) в соответствии с инструкциями производителя. Обнаружение RSV и hMPV выполняли с использованием собственной мультиплексной одностадийной ОТ-ПЦР в реальном времени на основе TaqMan. Праймеры и зонды нацелены на ген M RSV и ген F hMPV (таблица 1). Зонд RSV метили 6-карбоксифлуоресцеином (FAM) на 5′-конце и гасителем черной дыры-1 (BHQ-1) на 3′-конце. Зонд hMPV метили 6-карбоксифлуоресцеином (HEX) на 5′-конце и гасителем черной дыры-1 (BHQ-1) на 3′-конце. Реакционная смесь содержала 2 мкл РНК, по 10 мкмоль каждого из праймеров и зондов и реагент SensiFAST Probe No-ROX One-Step (Bioline, Лондон, Великобритания).Параметры цикла включали 1 цикл в течение 20 минут при 42 ° C, начальную денатурацию в течение 3 минут при 95 ° C, 50 циклов в течение 10 секунд при 95 ° C и 20 секунд при 60 ° C. Этот анализ имеет предел обнаружения 100 копий генома на реакцию для обоих вирусов. Никаких перекрестных обнаружений между двумя вирусами и другими респираторными вирусами, включая вирусы гриппа A и B, аденовирус, энтеровирус, риновирус и коронавирус, не наблюдалось. Анализ вирусов гриппа A и B в режиме реального времени был описан ранее (Suwannakarn et al., 2008). Параллельное обнаружение гена глицеральдегид-3-фосфатдегидрогеназы (GAPDH) служило внутренним контролем. Порог цикла сигналов флуоресценции (Ct) был основан на оптимизации, и значения ≤38 считались положительными.

    Таблица 1:

    Праймеры и зонды, используемые для обнаружения RSV, hMPV и вируса гриппа.

    Вирус Праймер / зонд Последовательность 5’– 3 ‘ Цель Позиция
    Анализ 1 RSV A и B RSV_F3251 GGCAAATATGGAAACATACGTGAA M 3251-3274 (+)
    RSV_R3334 TCTTTTTCTAGGACATTGTAYTGAACAG M 3334-3361 (-)
    RSV_P3303 FAM-CTGTGTATGTGGAGCCTTCGTGAAGCT-BHQ1 M 3303-3329 (+)
    hMPV A и B hMPV_F3604 CAARTGYGACATTGCTGAYCTRAA F 3604-3628 (+)
    hMPV_R3683 ACTGCCGCACAACATTTAGRAA F 3683-3662 (-)
    HMPV_P3630 JOE-TGGCYGTYAGCTTCAGTCARTTC-BHQ1 F 3630-3643 (+)
    Анализ 2 a Грипп A FluA-M-F151 CATGGARTGGCTAAAGACAAGACC M 151-175 (+)
    FluA-M-R276 AGGGCATTTTGGACAAAKCGTCTA M 276-252 (-)
    FluA-M-P218 FAM-ACGCTCACCGTGCCCAGT-BHQ1 M 218-235 (+)
    Грипп B FluB-MF439 CTCTGTGCTTTRTGCGARAAAC M 439-460 (+)
    FluB-MR CCTTCYCCATTCTTTTGACTTGC M 671-649 (-)
    FluB-P135 Cy5-TCAGCAATGAACACAGCAA-BHQ3 M 541-559 (+)
    Грипп A / h2N1 h2_F ACTACTGGACTCTGCTKGAA h2 750-769 (+)
    h2_R AAGCCTCTACTCAGTGCGAA h2 846-827 (-)
    h2_P FAM-TTGAGGCAAATGGAAATCTAATAGC-TAMRA h2 789-813 (+)
    Грипп A / h4N2 h4_F TGCTACTGAGCTGGTTCAGAGT h4 139-160 (+)
    h4_R AGGGTAACAGTTGCTGTRGGC h4 322-302 (-)
    h4_P HEX-AGATGCTCTATTGGGAGACC-BHQ1 h4 226-245 (+)
    GAPDH GAPDH-F85 GTGAAGGTCGGAGTCAACGG GAPDH 85-104 (+)
    GAPDH-R191 TCAATGAAGGGGTCATTGATGG GAPDH 191-169 (-)
    GAPDH-P121 HEX-CGCCTGGTCACCAGGGCTGC-BHQ1 GAPDH 121-140 (+)

    DOI: 10.7717 / peerj.6748 / таблица-1

    Обычная RT-PCR

    Образцы с положительным результатом на RSV и / или hMPV были генотипированы. Комплементарную ДНК синтезировали с использованием системы обратной транскрипции ImProm-II (Promega, Мэдисон, Висконсин, США) в соответствии с инструкциями производителя. РНК и случайные гексамеры инкубировали при 70 ° C в течение 5 минут с последующим удлинением в течение 2 часов при 42 ° C и инактивацией при 70 ° C в течение 15 минут. Амплификацию гена частичного гликопротеина (G) RSV, включая вторую гипервариабельную область (HVR2) и ген F, проводили с использованием полувложенной ОТ-ПЦР, как описано ранее (Auksornkitti et al., 2014). Параметры цикла: начальная денатурация при 94 ° C в течение 3 минут, 40 циклов денатурации при 94 ° C в течение 20 с, отжиг при 55 ° C в течение 20 с, удлинение при 72 ° C в течение 90 с и окончательное удлинение при 72 °. C в течение 10 мин. Идентичные параметры амплификации были выполнены во втором раунде ПЦР в течение 30 циклов. Частичный F-ген hMPV подвергали гнездовой ПЦР, как описано ранее (Chung et al., 2008). Условиями ПЦР были: начальная денатурация при 95 ° C в течение 3 минут, 35 циклов при 95 ° C в течение 1 минуты, 55 ° C в течение 1 минуты, 72 ° C в течение 1 минуты и окончательное удлинение при 72 ° C в течение 3 минут.Продукты ПЦР для RSV-A (840 п.н.), RSV-B (720 п.н.) и hMPV (750 п.о.) визуализировали с помощью электрофореза в 2% агарозном геле и очищали с помощью набора для экстракции геля GeneAll Expin (GeneAll Biotechnology, Сеул, Южная Корея) согласно инструкции производителя. Очищенные продукты ПЦР подвергали секвенированию по Сэнгеру.

    Последовательность и филогенетический анализ генотипов RSV и hMPV

    Нуклеотидные последовательности штаммов RSV и hMPV были выровнены с помощью ClustalW, реализованного в BioEdit (версия 7.0.9) по сравнению с последовательностями, ранее отнесенными к конкретным генотипам (таблица S1 и таблица S2). Филогенетические деревья были построены с использованием метода максимального правдоподобия, реализованного в MEGA6 (Tamura et al., 2013). Надежность дерева, основанного на модели Тамуры – Неи, была оценена с использованием 1000 бутстрэп-псевдорепликаций. Последовательности считались одним и тем же генотипом, если они группировались вместе со значениями начальной загрузки 70–100% (Venter et al., 2001).

    нуклеотидных последовательностей были представлены в базе данных GenBank под номерами доступа Mh547703 – Mh547725 (RSV-A), Mh547726 – Mh547818 (RSV-B) и Mh547819 – Mh547950 (hMPV).

    Статистический анализ

    Связь между распространенностью вируса и возрастом пациента на момент инфицирования оценивалась с помощью одномерного анализа (версия программного обеспечения SPSS 22.0). P -значения были рассчитаны с использованием критерия хи-квадрат или точного критерия Фишера, где использовалось количество клеток ниже 5. Статистически значимым считалось значение p <0,05.

    Результаты

    Общая распространенность RSV, hMPV и вируса гриппа

    Мы ретроспективно протестировали 8842 последовательных респираторных образца (48.5% мужчин в возрасте 0–106 лет). Из них 30,5% (2 699/8 842) были положительными на один или несколько вирусов. Чаще всего выявлялся вирус гриппа (17,3%, 1528/8842), за ним следуют RSV (11,4%, 1011/8842) и hMPV (3,6%, 318/8842) (таблица 2). Вирус гриппа и RSV были более распространены в 2016 году, чем в 2017 году. Для облегчения анализа образцы были разделены на семь групп, чтобы изучить распределение вирусной инфекции по возрасту (таблица 3 и таблица S3). Независимо от пола, бремя RSV было наибольшим среди детей в возрасте 5 лет и младше (21.2% и 15,4% среди лиц младше 2 и 3-5 лет соответственно). Частота инфицирования RSV снижалась с увеличением возраста и составляла <9% у лиц старше 5 лет ( p <0,0001). Напротив, инфекция вирусом гриппа чаще встречалась у пожилых людей. Между тем инфекция hMPV была распространена среди всех возрастов (1,7–5,7%).

    Таблица 2:

    Общая распространенность образцов, положительных на RSV, hMPV или вирус гриппа.

    Год Кол-во образцов Вирус-положительные образцы (%) RSV-положительные (%) hMPV-положительных (%) Положительные по вирусу гриппа (%)
    2016 4 178 1428 (34.2) 590 (14,1) 114 (2,7) 814 (19,5)
    2017 4,664 1271 (27,3) 421 (9,0) 204 (4,4) 714 (15,3)
    Всего 8 842 2699 (30.5) 1011 (11,4) 318 (3,6) 1528 (17,3)

    DOI: 10.7717 / peerj.6748 / table-2

    Таблица 3:

    Характеристики образцов и частота обнаружения RSV, hMPV и вируса гриппа.

    Характеристики Образцы (%) ( N = 8,842) RSV (%) ( N = 1011) hMPV (%) ( N = 318) Грипп A + B (%) ( N = 1,528)
    Возраст, год (среднее ± стандартное отклонение возраста) ≤2 (1.2 ± 0,6) 1 916 (21,7) 406 (21,2) 105 (5,5) 134 (7,0)
    3–5 (3,8 ± 0,8) 1541 (17,4) 238 (15,4) 88 (5,7) 160 (10.4)
    6–12 (8,4 ± 1,9) 1253 (14,2) 100 (8,0) 25 (2,0) 298 (23,8)
    13–18 (15,2 ± 3,2) 371 (4,2) 19 (5.1) 10 (2,7) 101 (27,2)
    19–30 (25,4 ± 3,2) 1148 (13,0) 66 (5,7) 20 (1,7) 211 (18,4)
    31–60 (41.4 ± 8,1) 2164 (24,5) 144 (6,7) 53 (2,4) 516 (23,9)
    > 60 (72,0 ± 9,1) 449 (5,1) 38 (8,5) 17 (3,8) 108 (24.1)
    p — значение 0,0262 0,5695 <0,0001
    Пол Мужской 4288 (48,5) 514 (50.8) 160 (50,3) 742 (48,6)

    DOI: 10.7717 / peerj.6748 / таблица-3

    Сезонное и генотипное распределение RSV, hMPV и вируса гриппа

    Распространенность гриппоподобной инфекции вирусной этиологии среди исследованных вирусов несколько различалась. Среди 1 011 RSV-положительных образцов выявление подгрупп было возможным для 488 образцов.Из них 36,3% (177/488) были RSV-A и 66,4% (324/488) были RSV-B. Инфекция RSV чаще всего появлялась в дождливые месяцы (с июля по ноябрь) с максимальной годовой распространенностью 37% (206/555) и 17,3% (136/784) в августе 2016 года и сентябре 2017 года соответственно (рис. 1A). Хотя RSV-A и RSV-B были одинаково обнаружены в 2016 году, RSV-B выявлялся чаще в 2017 году. Из 318 hMPV-положительных образцов идентификация подгруппы была возможна для 132 образцов. Из них 80,3% (106/132) были hMPV-B, которая была преобладающей подгруппой в оба года (рис.1Б). Из 1528 проб, положительных на вирус гриппа, было больше вируса гриппа A (76,2%, 1164/1528), чем вируса гриппа B (23,8%, 364/1528). В 2016 г. высокая распространенность вируса гриппа наблюдалась дважды: 20,5% (59/288) в марте и 34,5% (234/678) в сентябре (рис. 1C). В следующем году пик активности вируса гриппа пришелся на август (25,3%, 185/732). В целом, A / h4N2 составлял 70% (815/1164) всех вирусов гриппа А.

    Рисунок 1: Сезонное распределение инфекции для каждого вируса.

    Ежемесячное количество образцов от пациентов с гриппоподобным заболеванием (ГПЗ) показано серым цветом (правая шкала). (A) Гистограммы показывают уровень RSV-положительных результатов: RSV-A — желтым, а RSV-B — зеленым (левая шкала). (B) Гистограммы показывают уровень hMPV-положительных результатов с hMPV-A синим цветом и hMPV-B красным (левая шкала). (C) Гистограммы показывают частоту инфицирования вирусом гриппа A (темно-зеленый) и гриппа B (светло-зеленый) с A / h2N1 оранжевым и A / h4N2 розовым (левая шкала).

    Генотипирование и филогенетический анализ RSV и hMPV

    Частичные последовательности гена G, выбранные случайным образом для идентификации генотипов RSV, показали, что все штаммы RSV-A (23/23) относятся к генотипу ON1, а все штаммы RSV-B (93/93) относятся к генотипу BA9 (рис.2А и 2Б соответственно). Межподгрупповое разнообразие между A_ON1 и B_BA9 было относительно высоким (значение p-расстояния 2,17–2,44). Напротив, генетические вариации среди штаммов внутри генотипа были относительно небольшими ( p — значение расстояния 0–0,073 и 0–0,071 в генотипах ON1 и BA9, соответственно).

    Рисунок 2: Филогенетический анализ подгрупп А и В RSV на основе нуклеотидной последовательности, охватывающей область HVR2 в гене G.

    Деревья были построены с использованием метода максимального правдоподобия на основе модели Тамура – ​​Неи и реализованы в MEGA6.На узлах ветвления указаны значения начальной загрузки 1000 псевдорепликаций> 70%. Эталонные последовательности для каждого генотипа (GA1 – GA7, SAA1, NA1 – NA4 и ON1 для RSV-A и GB1 – GB4, SAB1 – SAB4, URU1, URU2, THB и BA1 – BA10 для RSV-B) были получены из GenBank. . Масштабная линейка представляет количество замен нуклеотидов на сайт между близкими родственниками. Кружками обозначены образцы из Таиланда 2016 г., а квадратами обозначены штаммы из Таиланда 2017 г. Число штаммов указано в скобках.

    Неполные последовательности гена F были получены из 132 из 318 hMPV-положительных образцов. Филогенетический анализ 132 штаммов hMPV, идентифицированных в этом исследовании, показал две основные генетические линии, A и B. Штаммы сгруппированы в подгруппу A2, B1 и B2, но не подгруппу A1 (рис. 3). Большинство штаммов относились к подгруппе B1 (74%, 98/132), и только 6% (8/132) относились к подгруппе B2. Остальные 20% штаммов (26/132) относились к подгруппе А2. Штаммы внутри генотипа были генетически близкими ( p — значения расстояния 0.001–0,019), тогда как сравнения между подгруппами были более разнообразными ( p — значения расстояния 0,087–0,116).

    Рисунок 3: Филогенетический анализ hMPV подгрупп A и B на основе частичной нуклеотидной последовательности гена F.

    Дерево было построено с использованием метода максимального правдоподобия и модели Тамуры – Нея, реализованной в MEGA6. Надежность дерева оценивалась с использованием 1000 псевдорепликатов начальной загрузки. Значения начальной загрузки> 70% указываются на узлах ветвления.Эталонные последовательности для каждого генотипа (A1, A2, B1 и B2) были получены из GenBank. Масштабная линейка представляет количество замен нуклеотидов на сайт между близкими родственниками. Кружками обозначены образцы из Таиланда 2016 г., а квадратами обозначены штаммы из Таиланда 2017 г. Число штаммов указано в скобках.

    Коинфекции между RSV, hMPV и вирусом гриппа

    Были исследованы частота единичных и множественных инфекций и количество одновременных вирусов для каждой возможной комбинации вирусов (таблица 4).Наиболее частой наблюдаемой комбинацией был RSV (нетипированный) и подтип h4N2 гриппа A ( n = 68). В процентном отношении вирусом, наиболее часто обнаруживаемым при коинфекциях, был RSV, который был обнаружен в 17,4% (176/1011) образцов, за ним следовали hMPV (10,4%, 33/318) и вирус гриппа (8,5%, 130 / 1528).

    Обсуждение

    Это исследование проводилось в течение двухлетнего периода с 2016 по 2017 год среди 8 842 пациентов с гриппоподобными инфекциями. Два мультиплексных анализа полимеразной цепной реакции с обратной транскриптазой (ОТ-ПЦР) в реальном времени были использованы для быстрого обнаружения трех наиболее распространенных респираторных респираторных возбудителей.Неудивительно, что наиболее распространенным вирусом был грипп (17,3%), за ним следовали RSV (11,4%) и hMPV (3,6%). Подобно нашим результатам, предыдущее исследование госпитализированных пациентов с инфекциями нижних дыхательных путей в Таиланде показало, что вирусы гриппа были наиболее распространенными респираторными вирусами, диагностируемыми среди случаев ГПЗ (Chittaganpitch et al., 2018). Распространенность RSV была самой высокой среди детей в возрасте до 5 лет, частота инфицирования составляла от 15,4 до 21,2%. С другой стороны, RSV имел меньшее бремя симптоматических респираторных заболеваний среди детей старшего возраста и взрослых, а в отношении инфекции вирусом гриппа наблюдалась противоположная тенденция.Доля пациентов с вирусными инфекциями гриппа увеличивалась с возрастом, а частота инфицирования была наибольшей у детей 13–18 лет (27,2%). Эти результаты подтверждаются ранее опубликованными исследованиями эпидемиологии респираторной вирусной инфекции (Zhang et al., 2014; Richter et al., 2016).

    Таблица 4:

    Вклад респираторных вирусов как единичных или коинфекционных.

    Вирус Всего Единичные инфекции Двойные инфекции Тройные инфекции Смешанная инфекция (%) RSV (нетипированный) RSV-A RSV-B чМПВ (нетип.) чМПВ-А2 чМПВ-Б1 чМПВ-Б2 Грипп-h2N1 Грипп-h4N2 Flu-B
    RSV (не типизировано) 527 397 128 2 25 . 0 0 0 18 1 1 1 23 68 20
    RSV А 176 158 18 0 10.2 0 13 1 0 1 0 1 2 0
    RSV B 321 293 27 1 8.7 0 13 3 1 1 0 2 6 3
    hMPV (кроме типовых) 186 161 22 3 13 . 4 18 1 3 0 0 0 1 3 2
    л.с. A2 26 24 2 0 7 . 7 1 0 1 0 0 0 0 0 0
    л.с. B1 98 93 5 0 5 . 1 1 1 1 0 0 0 1 0 1
    л.с. B2 8 7 1 0 12 . 5 1 0 0 0 0 0 0 0 0
    Грипп h2N1 349 321 28 0 8.0 23 1 2 1 0 1 0 0 0
    Грипп h4N2 815 738 75 2 9 . 4 68 2 6 3 0 0 0 0 0
    Грипп B 364 338 24 1 6.9 20 0 3 2 0 1 0 0 0

    DOI: 10.7717 / peerj.6748 / table-4

    В настоящем исследовании сезонное распределение инфекций, вызванных вирусом гриппа, напоминало распределение инфекций RSV и hMPV, что аналогично данным предыдущих исследований (Richter et al., 2016; Парсания и др., 2016; Chittaganpitch et al., 2018). Хотя Таиланд географически расположен в северном полушарии, сезонность респираторных инфекций аналогична сезонности некоторых близлежащих тропических регионов, таких как Индонезия, Малайзия, Филиппины и страны Южного полушария, Австралия и Новая Зеландия (Weber, Mulholland & Greenwood, 1998 ; Paynter et al., 2015). В этих регионах пик респираторных инфекций обычно приходится на сезон дождей и снижается в жаркие и засушливые месяцы.Более того, исследование, проведенное в Бангладеш, выявило повышенный риск респираторных инфекций после дождливых дней, что указывает на связь между дождями и скученностью или близостью населения (Murray et al., 2012). В Таиланде период, когда учащиеся ходят в школу, совпадает с сезоном дождей, поэтому вполне возможно, что поведение хозяина связано с повышенным риском респираторной инфекции.

    В нашем исследовании обе подгруппы RSV A и B циркулировали в течение одного и того же сезона RSV, но относительные пропорции варьировали, поскольку подгруппа B встречалась чаще, чем подгруппа A в сезоне 2017 года.В нескольких предыдущих исследованиях, в том числе в нашей группе, сообщалось об изменении антигенного характера инфекции RSV с течением времени (Ohno et al., 2013; Hirsh et al., 2014; Fall et al., 2016; Auksornkitti et al., 2014; Thongpan et al. ., 2017). Было высказано предположение, что периодические сдвиги в преобладающей подгруппе RSV обусловлены динамикой популяционного иммунитета и коллективного иммунитета, специфичного для подгруппы (Botosso et al., 2009). Что касается взаимосвязи между клинической тяжестью инфекции и типами и подтипами RSV, некоторые исследования показали, что инфекция RSV группы A была связана с повышенной тяжестью заболевания (McConnochie et al., 1990; Jafri et al., 2013), в то время как другие исследования показали, что инфекция RSV группы B приводит к более тяжелому заболеванию (Hornsleth et al., 1998; Tran et al., 2013). В настоящем исследовании возникающие генотипы ON1 и BA9 полностью заменили предыдущие генотипы, такие как NA1 и другие генотипы BA, которые были обнаружены в других странах (Dapat et al., 2010; Esposito et al., 2015), хотя в нем Было замечено, что они не вызывают более серьезных заболеваний, чем другие генотипы (Panayiotou et al., 2014).

    Филогенетический анализ гена F hMPV в настоящем исследовании показал, что оба типа A и B совместно циркулировали в Таиланде в течение двухлетнего периода исследования. Подобно нашим результатам, все три подтипа hMPV (A2, B1 и B2) ежегодно совместно циркулировали в других исследованиях, включая Южную Корею, Италию, Австралию и Норвегию (Gerna et al., 2005; Mackay et al., 2006; Chung et al., 2008; Moe et al., 2017). Хотя генотип hMPV может быть более вирулентным, чем генотип B (Vicente et al., 2006), имеющиеся в литературе данные о связи между клиническими симптомами и генотипом hMPV остаются неясными, поскольку некоторые авторы показывают более высокую тяжесть заболевания (Vicente et al., 2006; Arnott et al., 2013), а другие — нет (Agapov et al., 2006; Manoha et al., 2007). Кроме того, распространенность в основном гриппа A h4N2

    Острые респираторные заболевания

    Туберкулез (ТБ)

    Туберкулез (ТБ) — потенциально смертельное инфекционное заболевание, вызываемое бактерией под названием Mycobacterium tuberculosis (M. tuberculosis). Бактерии обычно поражают легкие, но могут поражать любую часть тела, включая почки, позвоночник и мозг; это чаще встречается у маленьких детей или детей с ослабленной иммунной системой.У большинства людей, инфицированных туберкулезом, нет симптомов (латентный туберкулез), но без лечения около 10% разовьются в активной форме. Почти 10 миллионов человек во всем мире имеют активную болезнь, и около 1,5 миллиона умрут от инфекции, в основном в развивающихся странах. Активная инфекция легких характеризуется хроническим кашлем с кровянистой слизью, лихорадкой, ночным потоотделением и потерей веса. Это очень заразное заболевание распространяется по воздуху, когда человек с активной легочной инфекцией кашляет, чихает, сплевывает или говорит.Факторы риска развития ТБ включают ВИЧ, перенаселенность, недоедание, хронические заболевания легких, курение и воздействие иммунодепрессантов, таких как кортикостероиды и антитела против TNF. Антибиотики используются для лечения латентных и активных инфекций ТБ, но лечение может занять несколько месяцев. Для предотвращения развития резистентности используются комбинации антибиотиков, но штаммы с множественной лекарственной устойчивостью растут.

    Исследования вакцин основаны на способности правильно подвергать испытуемых воздействию M.туберкулезный штамм. Использование плетизмографов, масок или шлемов от DSI позволяет доставлять аэрозоль одновременно с измерением частоты дыхания и дыхательного объема. Это помогает создать воспроизводимый и более точный метод доставки в легкие.

    Источники, использующие решения плетизмографа для исследования туберкулеза:

    Сибли Л., Деннис М., Сарфас К., Уайт А., Кларк С., Глисон Ф., Макинтайр А., Рейнер Е., Пирсон Г., Уильямс А., Марш П., Шарп С.«Путь доставки в дыхательные пути влияет на распространение легочного заболевания, но не на исход инфекции Mycobacterium tuberculosis у макак-резус». Туберкулез. 2016; 96: 141-149.

    Шарп С., МакШейн Х., Деннис М., Басараба Р., Глисон Ф, Холл Г., Макинтайр А., Гуч К., Кларк С., Беверидж Н., Нут Е., Уайт А., Марриотт А., Доулл С., Хилл А., Уильямс А., Марш П. «Создание модели аэрозольного заражения туберкулезом у макак-резус и оценка конечных точек для тестирования вакцины.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *