Горчичники при бронхите куда ставить взрослому: Горчичники при кашле: особенности применения и противопоказания

Содержание

Горчичники при кашле — советы, как правильно ставить взрослым и детям

Здравствуйте, дорогие читатели. Вместе с наступлением холодов постепенно приближается и сезон простудных заболеваний, которого все так боятся. Но настигнет простуда лишь тех, кто не успел подготовить свой иммунитет к таким сложностям. Так или иначе, риск простудиться существует для всех, вопрос лишь в том, как быстро ваш организм сможет справиться с поставленной задачей. В зависимости от индивидуальных особенностей организма, каждый человек переносит болезнь по-своему. Кого-то мучает субфебрильная температура и сильная боль в горле, а кто-то страдает от изнуряющего кашля, который не дает покоя ни днем, ни ночью. В общем-то, днем еще можно как-то отвлечься от этого неприятного симптома, а вот ночью все внимание заостряется именно на кашле, из-за чего он может усилиться. Проблема непрекращающегося кашля решается путем применения горчичников, которые достаточно быстро успокоят его приступы.

Таким образом, вам будет обеспечен крепкий сон по ночам, который так необходим для восстановления сил организма в период заболевания.

Ставятся горчичники не только для избавления от основных симптомов, но и для того, чтобы ускорить процесс выведения мокрот из легких. В противном случае, слизь, оставшаяся в дыхательных органах, может спровоцировать серьезные воспалительные процессы.

В чем заключается помощь горчичников?

Главный плюс данного средства в том, что применяется оно непосредственно на грудную клетку, точнее, на органы, находящиеся в ней. Горчичники способствуют глубокому прогреванию органов дыхания, что, собственно, и поможет справиться с мучительным кашлем.

Обратите внимание, что проводится такая процедура лишь в случае затяжного кашля. Поэтому на начальных стадиях заболевания лучше всего бороться при помощи препаратов общего применения.

Кроме того, горчичники применяются еще и в качестве профилактики при сильном переохлаждении организма.

Ведь в таком случае, существует риск развития воспаления легких, а этот процесс, лучше предотвратить.

Горчичные пластыри применяются в борьбе с такими заболеваниями:

— бронхит;

— бронхопневмония;

— трахеит;

— инфекционные поражения верхних дыхательных путей.

Лечебные свойства горчичников заключаются в том, что состав самой горчицы богат высоким содержанием эфирных масел, которые способствуют расширению сосудов, что и дает согревающий эффект. То, что они применяются только на область грудной клетки, еще не означает, что воздействуют они исключительно на бронхи.

Прогреваются все дыхательные пути, как нижние, так и верхние. Поэтому есть смысл использовать горчичники как вспомогательное средство против насморка и болей в горле.

Горчица содержит в себе специальные веществе, именуемые «глюкозидами», которые как раз и помогают достичь раздражающего действия. Через расширенные поры, средство проникает в кожу, при этом, ускоряет обменные процессы в организме.

Благодаря своему согревающему действию, данное средство назначается не только при простудных заболеваниях, но и при невралгии и даже радикулите. Кровь приливает к воспаленным участкам тела, что в значительной степени ускоряет восстановительные процессы организма.

В каких случаях нужно ставить горчичники?

Такое средство принесет положительный результат при бактериальных заболеваниях, последствием которых является сухой или влажный кашель. Если мокроты выводятся регулярно, то использование горчичников не будет обязательным.

Их можно применять только с целью ускорения этого процесса. А вот при сухом кашле данная процедура должна проводиться до тех пор, пока слизь не начнет выводиться.

Запомните, что при температуре, превышающей показатели 37,5 градусов, применение горчичников будет строго запрещено. Обменные процессы в организме и без того ускорены, а применение вспомогательных средств может привести к необратимым процессам.

Также не следует использовать согревающие средства при обструкции бронхов. На фоне такого синдрома применение горчичников может привести к развитию астмы, приступы которой являются достаточно опасными для жизни.

Заболевания, сопровождающиеся кровотечениями органов дыхания, также запрещается лечить при помощи средств с разогревающим эффектом.

Принцип действия

По сути, горчичник представляет из себя небольшой бумажный пакет, содержащий в себе измельченные высушенные семена горчицы. До недавнего времени, именно так и выглядели горчичники.

Но сейчас все чаще можно встретить горчичные пакеты нового поколения, одна часть которых имеет привычную бумажную структуру, а другая состоит из фольги.

Таким образом, происходит процесс отражения температуры, которая направляется исключительно разогрев тела. В общем-то, в этом есть какая-то логика, но пока подтверждений высокой эффективности данных горчичных пакетов нет.

Горчичники обладают следующими лекарственными действиями:

— при контакте горчичного пакета с влагой эфирные масла высвобождаются;

— применение такого средства приводит к раздражению кожи, что приводит к ускорению кровообращения;

— повышение температуры в области дыхательных путей приводит к разжижению мокрот, а также их дальнейшему выведению из органов дыхания;

— раздражение рецепторов кожи приводит к ускорению работы сердца, что, собственно, и способствует быстрому притоку крови к воспаленным тканям;

— вместе с увеличением скорости кровообращения, ускоряются и другие процессы в организме.

Так, в крови накапливается достаточно большое количество адреналина, который только усиливает защитную функцию организма.

Как ставить горчичники при кашле взрослому. Куда ставить горчичники при кашле

Перед началом процедуры, необходимо как следует встряхнуть горчичники для того, чтобы содержимое равномерно распределилось по пакету.

Обратите внимание на целостность самого пакета, ведь в случае каких-либо повреждений его нельзя будет использовать.

Нельзя допустить попадания горчицы на кожу, так как это может привести к ее ожогу. А при каких-либо повреждениях кожи горчичники также нельзя ставить, ведь вещество может проникнуть в рану, что вызовет не самые приятные ощущения.

Для успешного проведения процедуры нам понадобится:

— Посудина с водой, температура которой составляет 45 градусов.

— Большое махровое полотенце.

— Плед.

У некоторых людей горчица может вызывать аллергию, поэтому перед началом процедуры необходимо провести небольшой тест на реакцию организма.

Если же аллергическая реакция все же проявилась, то проведение такой процедуры больному будет запрещена.

Место, которое будет обрабатываться, необходимо заранее протереть насухо.

Если же горчичники будут ставиться ребенку, то место фиксации лучше всего покрыть одним слоем бумажных салфеток. Дело в том, что кожа ребенка еще достаточно чувствительна, а это может привести к образованию ожога.

В ходе процедуры, важно следить за состоянием больного. В случае, если человек жалуется на сильные болевые ощущения в области фиксации горчичников, нужно срочно снять их с поверхности кожи. Пораженные участки кожи обрабатываются вазелином сразу же после снятия горчичных пакетов.

Горчичники при разных видах кашля

Перед тем, как приступить к самому применению горчичников, нужно ознакомиться с основными правилами проведения процедуры. Здесь важно правильно расположить сами пакетики, благодаря чему можно достичь ускорения отхождения мокрот.

Обратите внимание, что средство может находиться на поверхности кожи не более 15 минут, в противном случае на коже может появиться довольно сильное раздражение или даже ожог.

Поэтому постарайтесь не переусердствовать, чтобы лечение одного симптома не повлекло за собой возникновение массы побочных эффектов.

Лечение кашля при помощи горчичников состоит из проведения нескольких действий

  1. В небольшую миску с водой помещаем горчичные пакеты примерно на 10 минут. За это время горчица как следует прогреется и разбухнет до нужных размеров.
  1. По истечению времени, пакеты вынимаются и прикладываются к телу заболевшего человека.
  1. Для того, чтобы уберечь разогретое тело от возможных сквозняков и воздействия прохладного воздуха, необходимо утеплить его при помощи полотенца. Все тело больного укутывается теплым пледом.
  1. Максимум через 15 минут компресс снимается. Время процедуры может варьироваться в зависимости от возраста и индивидуальных особенностей организма.
  1. Горчицу, которая все же успела просочиться через пакет, необходимо осторожно удалить с кожи при помощи теплой воды.
  1. Сразу же после этого, вытираем лишнюю влагу с кожи. Ведь остатки воды на разогретом теле могут привести к ухудшению состояния человека.
  1. На сухую кожу наносится небольшой слой вазелиновой мази, которая поможет восстановить ее от раздражающего воздействия горчицы.

Усилить эффект поможет чашка травяного чая или принятие горячей ванны. Но не забывайте, что при высокой температуре тела проведение процедур согревающего действия будет запрещено.

Поэтому в случае повышения температуры, необходимо уложить больного в постель и слегка накрыть пледом. Обратите внимание, что больному необходимо обеспечить именно теплое питье, ведь горячие напитки могут только усугубить ситуацию.

Ставить горчичники допустимо на протяжении пяти дней, после чего лечение следует прекратить.

Достаточно будет двух процедур в сутки для того, чтобы полностью избавиться от кашля. А вот длительный курс лечения может привести к повреждениям кожи. И запомните, важно знать, как правильно ставить горчичники при кашле взрослым и детям.

Борьба с сухим кашлем

Если же справиться с влажным кашлем будет довольно просто даже за пару дней, то сухой кашель придется лечить как минимум неделю.

Но здесь важно определить причину возникновения подобного воспалительного процесса. Ведь если она будет заключаться в инфекционном поражении организма, то горчичники только ускорят процесс распространения инфекции.

Поэтому ставить горчичники можно лишь в том случае, если он имеет бактериальное происхождение. Для того, чтобы окончательно распрощаться с этим неприятным симптомом, потребуется провести как минимум 6 процедур.

Кстати, не менее эффективным будет способ прикладывания горчичников к стопам больного. Так, согревание организма начнется с ног, которые всегда мерзнут в первую очередь.

Как правильно ставить горчичники при кашле

В зависимости от заболевания, компрессы размещаются на груди и на спине. Но существуют случаи, когда возникает необходимость в их установке сразу на обе стороны грудной клетки (спина и грудь). Куда ставить горчичники при кашле, может посоветовать вам врач, в зависимости от заболевания.

Но в таком случае потребуется дополнительная фиксация обеих пар пакетов. Сделать это можно при помощи бинта или марли.

А вот усилить эффект от горчичников можно при помощи простой пищевой пленки, которая одновременно может послужить и их фиксатором.

Что же касается продолжительности процедуры, то здесь все зависит от степени покраснения поверхности кожи.

В среднем, рекомендуется держать горчичники не более 10 минут. Если же такая процедура уже на первых минутах вызывает резкое жжение, то компресс необходимо срочно снять.

На какую часть грудной клетки ставятся горчичники?

В случае с кашлем, пакеты с горчицей располагаются на спине или грудине. Но если вас беспокоит насморк, то горчичники будут эффективны только, если их расположить в области икроножных мышц.

А вот при сильной заложенности носа, специалисты рекомендуют фиксировать пакеты на ступнях при помощи той же пищевой пленки или марли.

Поверх них на ноги надеваются шерстяные носки, которые обеспечат ногам тепло. Но прежде чем проводить подобную процедуру, убедитесь в том, что на пятках нет трещин. Справиться с затяжным кашлем помогут несколько эффективных способов.

  1. Если причиной возникновения кашля является бронхит, то горчичники ставятся одновременно на спину и грудь. При этом, размещаются они между лопатками. А вот на передней части грудной клетки фиксируются пакеты немного ниже ключиц. Здесь важно разместить компрессы на определенном расстоянии от области сердца.
  1. Сухой кашель можно излечить путем размещения горчичников между лопатками. Но процедура будет возможна только в том случае, если температура не превышает 37,5 градусов.

Продолжительность процедуры

В среднем, горчичники можно держать около 10 минут. Но если у вас слишком чувствительная кожа, то можно ограничиться и пятью минутами. Определить уровень чувствительности можно путем наблюдения за реакцией кожи на горчичные пакеты.

Конечно, если вы выдержите, то можно оставить горчичники на своем теле и на 20 минут, но делается это лишь в крайних случаях, когда кашель не покидает больного довольно длительное время. Но тогда нужно на протяжении всей процедуры следить за состоянием кожных покровов.

Время проведения процедуры может варьироваться не только в зависимости от реакции кожи, но еще и от возраста человека:

— малышам до трех лет подобные компрессы ставятся максимум на 3 минуты;

— от трех до семи лет можно увеличить время до 5 минут;

— начиная с восьми лет, можно держать горчичники около 10 минут.

Как часто можно ставить горчичники?

В данном случае, процедура может проводиться не больше двух раз в сутки. Злоупотреблять ними не стоит, ведь слишком частые повторения могут привести к перегреву организма, что не самым лучшим образом повлияет на ослабленный иммунитет. К тому же, воздействие горчицы на кожу может привести к образованию ожогов.

Людям с чувствительной кожей достаточно будет и одного компресса в день. Ну а если данный вид лечения не приносит никаких результатов даже на пятый день, то следует подобрать другие методы лечения.

Как ставить горчичники ребенку — применение горчичников для детей

Кожа детей слишком чувствительна к различным внешним раздражителям, результатом чего может стать аллергическая реакция или механические повреждения в виде ожогов.

Поэтому прикладывается смоченный в горячей воде горчичник только на хлопчатобумажную ткань, размещенную на грудной клетке ребенка.

Желательно применять такой вид лечения только с шести лет, ведь до этого возраста невозможно предугадать реакцию организма на такое средство.

Процедура производится следующим образом: 

  1. Горчичные пакеты помещаются в теплую воду на полминуты.
  1. Прикладываем их к спине малыша и накрываем полотенцем.
  1. По истечению десяти минут снимаем компресс и удаляем остатки горчицы при помощи теплой воды.
  1. Покрываем кожу небольшим слоем вазелина.

Применение горчичных компрессов при беременности

Вообще лечить кашель при помощи горчичников в данном случае нежелательно, ведь они способствуют повышению тонуса матки. Поэтому назначаются такие процедуры лишь в крайних случаях и только врачом.

Противопоказания и побочные действия

Запомните, что использование горчичников при инфекционных заболеваниях будет не только безуспешным, но еще и опасным для здоровья и жизни человека.

А запрещается применение такого средства в следующих случаях:

— аллергия;

— туберкулез;

— легочные кровотечения;

— ранние повреждения кожи;

— астма;

— псориаз.

Игнорирование противопоказаний может привести к сильным раздражениям кожи, аллергическим высыпаниям и даже ожогам. Поэтому не стоит самостоятельно увеличивать время продолжительности процедуры.

Горчичники при кашле могут применяться только по назначению врача и только с учетом четких правил применения. При правильном использовании, такое средство поможет справиться даже с самым сильным кашлем, что также убережет вас от возможных осложнений.

Как ставить горчичники при сухом кашле, бронхите и при насморке у ребенка | ДетскийДзен

Прогревание горчичниками – один из самых эффективных методов лечения сильного кашля, вызванного простудными заболеваниями. Однако, несмотря на эффективность, этот метод имеет существенный недостаток: процедура достаточно болезненна из-за жжения, вызванного прямым контактом горчичника с кожей человека.

Прогревание горчичниками – один из самых эффективных методов лечения сильного кашля, вызванного простудными заболеваниями. Однако, несмотря на эффективность, этот метод имеет существенный недостаток: процедура достаточно болезненна из-за жжения, вызванного прямым контактом горчичника с кожей человека.

Но взрослый человек может потерпеть 2-5 минут (именно столько длится процедура лечения), а как быть, если процедура назначена ребёнку?

Особенно если ребёнок маленький, терпеть ещё не умеет, да и вряд ли хочет. Однако врачи настоятельно рекомендуют лечить детский кашель именно этим жгучим средством. Так ли эффективны горчичники на самом деле?

Насколько эффективны горчичники в лечении кашля у детей?

Это средство для лечения кашля как у взрослых, так и у детей применяется уже очень много лет, и за это время успело завоевать хорошее расположение не только среди следователей народной медицины, но и среди обычных врачей.

Это свидетельствует о высокой эффективности и безопасности данного метода, поэтому его применение для лечения детей раннего и среднего возраста вполне оправдано.

Как лечит горчичник?

Многие интересуются, каким образом горчичники воздействуют на воспаление в дыхательных путях. На самом деле, механизм действия очень прост:

  • Нагретый состав, основой которого является горчичный порошок, раздражает рецепторы кожи;
  • Происходит расширение кровеносных сосудов, в связи с чем кровь начинает усиленно поступать в область наложения горчичников;
  • Улучшение кровотока в области воспаления способствует обеспечению клеток кислородом и веществами, необходимыми для борьбы с вирусами.

Кроме того, согревающее действие способствует разжижению и ускоренному отделению мокроты, что помогает вылечиться намного быстрее.

Как правильно выбрать и приготовить горчичник

Магазинный вариант горчичников – листы плотной бумаги или пластыря, на которые нанесен состав из горчичного порошка, сахара и некоторых других компонентов. По каким критериям выбрать хороший горчичник?

  • Масса должна плотно держаться на бумаге.
  • От горчичников не должно быть затхлого или неприятного запаха кислоты.
  • При смачивании теплой водой горчичник должен источать резкий запах, свойственный эфирному маслу горчицы.

Приготовить такое средство самостоятельно совсем несложно. Традиционный рецепт таков: Берем три столовые ложки порошка горчицы (обязательно используйте свежий), столько же муки и разводим теплой водой, чтобы масса была похожа на густое тесто.

Берем небольшие листы плотной бумаги, наносим на них горчичную массу слоем в 1 см. Кладем листы на марлю и применяем, как обычно.

Как самим сделать горчичники и как их ставить при детском кашле

Есть несложный способ, проверенный, удобный. Кстати, применять его можно не только для лечения детей, но и взрослых тоже:

Есть несложный способ, проверенный, удобный. Кстати, применять его можно не только для лечения детей, но и взрослых тоже:

  • Приготовьте три кусочка бинта или марли, каждый из которых размером чуть больше горчичника. Если бинта или марли нет, можно использовать старую хлопчатобумажную ткань, желательно тонкую. Эти салфеточки смочите растительным маслом, чтобы пропитались полностью.
  • Приложите по одной масляной салфеточке на каждую лопаточку ребёнка, в том место, куда будете ставить горчичники.
  • Смочите горчичники в тёплой воде. Желательно, чтобы температура воды была чуть выше температуры тела человека. Горчичники приложите обратной стороной к масляным салфеточкам на спинке ребёнка. Накройте сухой салфеткой или полотенцем. Слегка прижмите, чтобы горчичники плотнее прилегли к спине. Уложите ребёнка спинкой на подушку. Аналогичным образом поставьте горчичник на грудь. Укройте одеялом.

Благодаря масляным салфеткам и прикладыванию горчичников обратной стороной жжения не будет.

Отсутствие жжения вы увидите по поведению ребёнка: он будет вести себя спокойно, поскольку процедура совсем не болезненна, скорее даже приятна.

Тепло будет нарастать медленно, постепенно. Вместо 2-5 минут процедура длится 30-40 минут, в зависимости от степени свежести горчичников. Вы получите интенсивное прогревание грудной клетки.

Конечно, за процедурой надо следить. Минут через 15-20 начинайте «посматривать», слегка открывая горчичник на груди. Когда кожа под горчичником станет темно-розового цвета, процедуру можно заканчивать.

После того как горчичники сняты, рекомендуется спинку и грудь смазать скипидарным (или другим согревающим) маслом.

Надеть хлопчатобумажную сорочку или футболку, сверху – тёплую жилетку, джемпер или свитер без воротника. Согревающая мазь и тёплая одежда позволят продлить эффект от горчичников.

При этом, если в комнате тепло, можно не накрывать ребёнка одеялом, чтобы ему не было жарко, закройте только ножки, дайте попить.

Процедура закончена. Утром вы увидите эффект: ребёнку станет намного легче.

Что делать родителям если ваш малыш гиперактивный. Психолог рекомендует не расстраиваться и найти подход к ребенку.  Читаем статью полностью…

Что делать родителям если ваш малыш гиперактивный. Психолог рекомендует не расстраиваться и найти подход к ребенку.  Читаем статью полностью…

Соблюдайте осторожность!

  • Но имейте в виду, что применять лечение горчичниками, как и любые тепловые и согревающие процедуры, можно только при отсутствии высокой температуры, иначе вы рискуете усугубить ситуацию.
  • Делать процедуру исключительно на ночь, потому что днем ребенок может проявлять активность, простудить тело после прогревания и заболеть еще сильнее.
  • В случае необходимости (если кашель сильный, и одна процедура не принесла значительного улучшения) повторять лечение через день.

Куда ставить и сколько держать?

Как правильно поставить ребенку горчичники (инструкция).

1. Аккуратно открыв упаковку с горчичниками, нужно окунуть их в горячую воду на несколько секунд, а затем приложить «рабочей стороной» к коже больного.

Запомните, если ребенок слишком маленький и имеет крайне чувствительную кожу, то такая техника постановки горчичников может вызвать ожог. Годовалому ребенку следует прикладывать горчичники обратной стороной, или же покрыв кожу предварительно тоненькой хлопчатобумажной тканью, поверх которой поставить горчичники.

2. Поверх горчичников оберните ребенка полотенцем, и укутайте теплым одеялом.

Как ставить ребенку горчичники. Фото:

При лечении кашля у детей обычные горчичники из магазина следует ставить только на спину, держать их нужно около 5 минут, после чего быстро снимать во избежание ожога.

Горчичники, приготовленные по вышеуказанному рецепту, необходимо держать на теле около получаса, а ставить не только на спину, но и на грудную клетку.

При каком кашле ставят горчичники детям?

Такую процедуру можно проводить при любом виде кашля (даже если он очень сухой), кроме аллергического и сопровождающегося высокой температурой.

Такую процедуру можно проводить при любом виде кашля (даже если он очень сухой), кроме аллергического и сопровождающегося высокой температурой.

Лечение горчичниками универсально, поэтому оно и применяется в больницах и назначается большинством педиатров при сильном кашле у детей.

Конечно, наиболее эффективно такое лечение при влажном кашле, часто бывает достаточно одной процедуры, чтобы легкие и бронхи ребенка очистились от мокроты.

Можно ли ставить горчичники при сухом кашле ?

При сухом кашле количество процедур должно быть увеличено, однако эффект тоже не заставит себя ждать.

Куда ставить горчичники детям при насморке?

Итак, лечим насморк у ребенка горчичниками. Куда ставить горчичник при кашле, понятно – на грудь и на спину в области бронхов и легких, а куда же ставить горчичники при насморке?

Основное место воздействия в случае насморка – ноги. Горчичники рекомендуется поставить на ступни, надеть хлопчатобумажные носочки, а затем шерстяные. Также нужно ставить горчичники на область икр и чуть-чуть ниже. Если ребенку больше года, можно на ночь насыпать сухой горчицы во вторые носочки, а сверху надеть еще одни.

Также можно воспользоваться горячими ванночками для ног: туда нужно насыпать сухой горчичный порошок из расчета на 10 литров воды 50 г порошка горчицы. Температура воды – примерно 45 градусов. Длительность процедуры – 15 минут, после чего ребенку нужно насухо вытереть ножки и надеть хлопковые и шерстяные носочки.

Куда и как ставить горчичники при бронхите ?
При бронхите горчичники нужно ставить одновременно на грудь и спину. На груди их располагают примерно на 5-10 см ниже каждой ключицы. Важно как можно меньше затронуть при этом область сердца. На спине горчичники нужно накладывать между лопатками, а также ниже них, чтобы эффект лечения был выше.

В среднем время аппликации составляет 5-10 минут. Действие горчичников не должно быть неприятным или болезненным. Если ощущается резкое и непереносимое жжение, процедуру пора прекращать. Также не рекомендуется держать горчичники на коже дольше десяти минут, так как может возникнуть неприятное и совершенно лишнее раздражение кожи.

С какого возраста их можно применять детям?
Ограничений по возрасту нет, можно ставить и грудничкам. Если нет аллергии на горчицу, различных кожных высыпаний и температура тела не превышает 37,5°С, то смело можете их использовать. Ведь горчичники всего лишь расширяют сосуды, улучшают кровообращение и обменные процессы.

Противопоказания к применению

  • Аллергия на эфирные масла;
  • Бронхиальная астма;
  • Высокая температура;
  • Острые кожные заболевания и повреждения, высокая чувствительность кожных покровов.

Лечение кашля у детей с использованием горчичников имеет хороший эффект и используется родителями десятков поколений.

Как ставить горчичники от кашля? | СТОП ОРВИ

Когда мучает сухой кашель, самое время вспомнить о старом, но весьма эффективном лекарстве – горчичниках.

С одной стороны, это средство весьма просто и доступное, ведь стоимость горчичников всем по карману, но вначале следует разобраться со всеми нюансами их применения. Ведь, принимая любое средство, главное – не навредить своему здоровью, то есть не переусердствовать. Поэтому ниже пойдет речь о том, подойдут ли горчичники при сухом кашле.

Когда ставить горчичники противопоказано

1. Это согревающая процедура, к ней нельзя прибегать, когда температура болеющего человека достигает высоких отметок.

2. Второе «нельзя» заключается в том, что горчичники противопоказаны, если на коже заметны какие-либо раздражения (присутствуют гнойничковые заболевания, раны, ожоги и т. д.).

3. Еще один запрет касается регулярности использования. Запрещается использовать горчичники дольше 4 дней подряд.

Если все эти предосторожности взяты во внимание, то можно переходить непосредственно к использованию.

Правила использования горчичников

Куда ставить горчичники? Все просто. При сухом кашле чаще всего их помещают на спину, грудь, под и между лопатками. Важно избегать области сердца, не класть горчичники на позвоночник. Популярно использование «горчичных сапог», когда горчичники ставят на ноги, а потом надевают шерстяные носки сверху.

Алгоритм применения

1. Взять горчичники, нагреть воду до 45 °C, полотенце, масло, одеяло или плед.

2. Опустить их на несколько минут в воду. Приложить к нужному месту, сверху накрыть полотенцем и укутать больного в одеяло.

Сколько времени горчичники находятся на теле? По словам врачей-физиотерапевтов, 5-10 минут будет достаточно для того, чтобы организм прогрелся. Жгучее действие можно снизить, положив между телом и горчичником салфетку (или использовать марлю). После того, как время выдержано, горчичники снимают, кожу аккуратно протирают полотенцем, смазывают маслом. Важно снова укутать больного и обеспечить покой.

Если начинается жжение или кожа покраснела, нужно сразу же убрать горчичник. А пораженный участок промыть теплой водой и намазать вазелином или растительным маслом. Подойдет и модное средство «Пантенол». Не применяйте препараты, содержащие спирт.

Горчичники для детей

Перед тем как прибегать к данному «бабушкиному» методу, следует ознакомиться с противопоказаниями. Нежелательно их использовать детям раннего возраста (малышам больше подойдут горчичные обертывания). Оптимально ставить горчичники с трехлетнего возраста.

Главное, при проведении этой процедуры тщательно следить за кожной реакцией. Дети могут не ощущать сильного жжения, и значительное покраснение кожи в результате перейдет в ожог. Или же другой вариант, когда незначительное покалывание дети воспринимают как боль и отказываются от продолжения процедуры.

В таком случае говорить об эффективности использования такого метода в борьбе с сухим кашлем не приходится. Во избежание такого исхода, можно воспользоваться советом по использованию салфетки или ставить горчичники на кожу ребенка обратной стороной (не намазанной).

При правильно поставленных горчичниках, лечение простудных заболеваний у детей даже эффективнее, чем у взрослых.

Совместимость беременности и использования горчичников

Невзирая на то, что производители горчичников не запрещают беременным их использование, вероятность угрозы организму существует. Горчичники при беременности противопоказаны по следующим причинам:

· повышают давление, сужая таким образом сосуды стенок матки;

· эффект согревания, который создают горчичники, приносит вред женщинам в положении.

Говорить об использовании горчичников в небольших количествах все же возможно, особенно, если проводить процедуру по внимательно изученной инструкции. Но так, как риск существует (пускай и самый минимальный), стоит задуматься о применении альтернативных способов лечения при беременности.

Как изготовить дома?

Для приготовления горчичников на заводе используют сизую или черную горчицу. Первым делом семена горчицы обезжиривают, потом подвергают измельчению и раскладывают по пакетам.

Чтобы сделать их дома вам понадобится сухой порошок горчицы, крахмал и вода. Полученная суспензия должна быть нанесена на плотную бумагу, а сверху накрыта марлей. Подождите, пока горчичник высохнет, и можете его использовать.

Ставят горчичники в случаях переохлаждения, чтобы избежать возникновения простудного заболевания. Также используют при боли в мышцах или гипертонии. Если вам срочно понадобились горчичники и нет времени заниматься изготовлением, вы всегда можете купить их в аптеке.

Источник stoporvi.ru. Оставайтесь с нами, каждый день новая и полезная информация! 🙂

Как правильно ставить горчичники при кашле и других заболеваниях

Вопрос о том, как правильно ставить горчичники, наверняка хотя бы раз интересовал любого человека. На самом деле проделывать такую процедуру вовсе не сложно. Главное – знать основные правила, благодаря которым действие горчичников будут наиболее эффективным. Итак, горчичники ставить нельзя в случае, если:

  • температура больного составляет 37,3 градуса и более, так как организм может не справиться с такой нагрузкой;
  • человек болен такими заболеваниями как псориаз, экзема, нейродермит или любые другие заболевания кожи;
  • женщина беременна или кормит грудью;
  • есть подозрение на злокачественные опухоли;
  • непереносимость или аллергия на горчицу.

Также, если вас интересует вопрос: «Как часто ставить горчичники?», то ответ будет прост. Не рекомендуется применять горчичники более четырех дней подряд. В день можно ставить только по одному горчичнику, желательно не в светлое время суток. Кроме того, после этой процедуры больному нужен длительный покой, поэтому применять горчичники в домашних условиях лучше всего перед тем, как отправиться ко сну.

Ставить горчичники детишкам нужно очень осторожно. Рекомендуемый возраст для горчичников – три года и выше, так как до этого у деток слишком нежная кожа. Детям от 3 лет горчичники ставить нужно не больше чем на 3 минуты. Снимать их нужно сразу же после того, как ребенок почувствует жжение.

Куда ставить горчичники?

Еще один интересный вопрос, который чаще всего возникает у многих людей, это: «Куда ставить горчичники?». Оно и не удивительно, ведь каждая точка на теле отвечает за свой внутренний орган. Горчичники ставятся не только на спину, но еще и на грудь, и на ноги. В каких случаях и куда правильно поставить горчичники, мы расскажем вам в нашей статье.

При кашле или простуде детям ставят горчичники на ноги. Обычно горчичники кладут в теплые шерстяные носки и оставляют на ногах на всю ночь, но если ребенок почувствует сильное жжение, то горчичники необходимо будет убрать.

Взрослым же при кашле ставятся горчичники на грудь или на спину в зависимости от локализации заболевания. При бронхите или ангине горчичники ставят на грудь, пытаясь избегать области сердца. При пневмонии или, как ее еще называют, воспалении легких, горчичники также следует ставить на грудь, но можно ставить и на спину. При этом нет разницы, сухие или мокрые горчичники вы используете. При трахеите горчичники накладываются на икры ног или на грудь.

Как правильно это делать?

Не менее важный вопрос: «Как правильно ставить горчичники?» — ведь именно от этого зависит эффективность всей процедуры. По сути, здесь нет ничего сложного. Тем не менее, мы решили составить небольшую инструкцию, чтобы вы точно знали, что все делаете правильно.

Итак, чтобы поставить горчичники, нужно:

  • Для начала подготовьте широкую тарелку с не очень горячей водой.
  • Перед применением каждый горчичник следует опустить в воду на 20 секунд, лучше всего в горизонтальном положении.
  • Далее можете прикладывать горчичник к требуемому месту больного, после чего его нужно будет прижать к телу с помощью сухой салфетки.
  • При первом применении горчичники нужно ставить не более чем на пять минут, увеличивая это время с каждым разом на две минуты.

При контакте с кожей горчичники могут вызвать покраснение. Но если вы почувствуете сильное жжение и боль, тогда нужно немедленно избавиться от горчичников и проверить, нет ли у вас на них аллергии.

В целом, если соблюдать все рекомендации, горчичники помогут вам или вашим детям избавиться от кашля и простуды в течение нескольких дней. В видео вы найдете больше подробностей на данную тему.

Горчичники при бронхите. Можно ли ставить? Как и куда правильно

Горчичники при бронхите – старый метод лечения респираторного заболевания. Страной изобретения является Франция. В современном формате они существуют с 1866 года благодаря фармацевту Жану-Полю Риголло.

Эффект основан на местном раздражающем действии. Горчичные аппликации используют только в качестве вспомогательного средства на фоне базовой терапии. Как правильно и безопасно их поставить? Нужно ли? Сначала следует ознакомиться с формами выпуска.

Виды горчичников. Форма выпуска

 

Они могут быть заводского и домашнего производства. Это дешевый и доступный препарат, поэтому лучше приобрести его в аптеке. Это поможет сэкономить время и убережет от ошибок при изготовлении.

Существует две формы выпуска. А именно:

  • Пластины. Состоят из прямоугольного листа бумаги и лекарственной основы. Горчичный порошок прикреплен к их поверхности с помощью контактной гель-смазки. Стандартный размер: 8 на 12,5 см.
  • Пакеты. Представляют мешочки из фильтровальной бумаги, в которые помещено растительное лекарственное сырье. В большей степени содержат горчичный жмых, измельченные ядра семян (до 76%) и в меньшей – порошок (до 24%).

Существуют пакеты, которые дополнительно включают небольшое количество эвкалиптового масла (до 1% от всей смеси). В аптечной сети предлагают бальзамы, гели, но технически они не относятся к горчичникам.

Отдельные разновидности с пометкой «для детей» выпускают, но принципиальных компонентных отличий от взрослых нет. Схема лечения будет разниться в длительности сеанса.

Можно ли при бронхите ставить горчичники?

Выполнять процедуру разрешено и взрослым, и маленьким пациентам. Важно помнить о том, что она подходит не при всех типах патологии.

Например, любые процедуры с горчицей нежелательно проводить при обструктивном бронхите. На фоне этого заболевания дыхательные пути склонны к спазму, отечны. Наложение пластин или пакетов в лучшем случае окажется бесполезным, в худшем – приведет к прогрессированию дыхательных нарушений.

Допустимо ставить при остром воспалении бронхов только в период выздоровления, когда нормализовалась температура тела. Например, чтобы справиться с остаточным кашлем. Выполнение процедуры на фоне активного воспаления приведет к ухудшению состояния.

Использование горчичного порошка не запрещено при хроническом бронхите без обструкции. Процедуру назначают также — только после преодоления острого периода.

Разрешено ставить детям, но существуют возрастные ограничения. К процедуре нельзя прибегать, если больному меньше 1 года.

Дошкольникам горчичные аппликации делать допустимо, но не рекомендуется. Возможны непредсказуемые побочные последствия при раздражении рефлексогенных зон.

Помогают ли горчичники при бронхите?

Некоторые пациенты считают, что основная их функция при бронхите – прогревание. На самом деле достоверных научных доказательств этого нет.

Горчица раздражает кожу, приводит к местной гипертермии. Но этого физически недостаточно, чтобы тепло глубоко распространилось в ткани под ней.

Предположительный механизм, благодаря которому горчица облегчает лечение бронхита – активация рефлексогенных участков кожи. Считается, что это приводит к улучшению кровотока в легких и ускорению течения заболевания.

Горчичные аппликации – популярная методика, но устаревшая. Использовать можно, но только на фоне полноценной основной терапии и применять в качестве дополнительного средства лечения для скорейшего выздоровления.

Противопоказания. Когда следует отказаться от применения?

Процедура разрешена не всем пациентам. Основные ограничения:

1

Гиперчувствительность. Горчица – довольно сильный аллерген, способный вызвать как местную реакцию (крапивницу), так и системную (анафилактических шок, отек Квинке). При малейших подозрениях на возможный атипичный ответ лучше вообще не класть горчичники при бронхите на любые участки тела.

2

Повреждения кожи. Горчица способна вызвать нестерпимое жжение в области порезов и ссадин.

3

Кожные заболевания. Например, атопический дерматит, экзема. Аппликации могут усугубить течение псориаза. Нельзя накладывать при гнойничковых поражениях (чревато усилением воспаления, распространением инфекции).

4

Гипертермия. Аллиловый эфир при повышенной температуре усилит и без того острое воспаление. Это может привести к срыву адаптационных механизмов больного организма.

5

Новообразования. Увеличение кровотока способно ускорить рост злокачественной опухоли и спровоцировать метастазирование. Нельзя ставить непосредственно на доброкачественные образования.

6

Возраст до 1 года. Можно получить химический ожог кожи. У детей несовершенная терморегуляция, поэтому аппликации способны привести к опасному перегреву организма.

Указанные противопоказания относились только к горчице (порошку, жмыху). Если в состав входит эвкалиптовое масло, то список ограничений будет дополнен склонностью к бронхоспазму.

Помните

Вдыхание паров горчичного масла опасно для детей с бронхиальной астмой, чревато удушьем при ларингите. При их наличии отказываются от любых процедур с горчицей.

Возможные побочные эффекты от использования

Осложнения обычно возникают местно, в участке наложения. К ним относятся аллергическая реакция и нестерпимое жжение. При нарушении техники выполнения возможен химический ожог.

Меры предосторожности

Чтобы избежать нежелательных эффектов, необходимо придерживаться нескольких правил. Горчичные аппликации должны вызывать ощущение тепла и легкого жжения. Если процедура провоцирует сильный дискомфорт, ее следует немедленно прекратить.

Нельзя превышать рекомендованное время. Горчица должна контактировать с кожей у взрослых не более 10-15 минут.

Клеить можно только на неповрежденную кожу. Нельзя ставить на позвоночник, невусы (родинки). Запрещено накладывать на область молочных желез и сосков, а также над сердцем.

В некоторых источниках пишут, что если кожа чувствительная, то пластины желательно поставить обратной стороной. Второй вариант решения проблемы – подкладывание тонкой бумаги, либо марли. На самом деле, в таких ситуациях лучше вообще отказаться от этой манипуляции (хуже без нее не будет).

Горчичники при бронхите: куда ставить взрослому?

Перед использованием следует убедиться в пригодности лекарства. Действующий порошок обладает острым горчичным запахом. Растительная основа не должна осыпаться с пластины.

Установить аппликации можно на спину и переднюю поверхность грудной клетки. Следует помнить о местах, которые нужно избегать.

Взрослым накладывают на область лопаток и чуть ниже. На передней поверхности грудной клетки пластинки, пакеты располагают под ключицами.

Как правильно ставить горчичники при бронхите? Техника выполнения:

  • Уложить пациента на живот на ровную поверхность. Для лучшего контакта с горчичниками увлажнить кожу.

Куда ставить: фото

  • Поместить пакеты, пластины в миску с водой на 10-20 сек. Это необходимо для высвобождения эфирного аллилового масла. Оптимальная температура составляет 37 °C. Если она будет выше + 45 °C, то действующее вещество разрушится.
  • Установить горчичные аппликации. Сверху накрыть сухой тканью и теплым одеялом. Для большей эффективности можно использовать полиэтиленовую пленку.
  • Проконтролировать ход процедуры. Через каждые 2-5 минут проверяют состояние кожи.
  • Завершить манипуляцию. Сколько держать? Не более 15 минут до появления стойкой красноты. Если возникло нестерпимое жжение, процедуру сразу прекращают.
  • Очистить кожу. Область наложения аккуратно протирают влажной, затем сухой тканью.

После аппликации рекомендовано полежать под одеялом в течения 1-2 ч. При бронхите можно ставить горчичники, чередуя участки тела. Например, сначала поместить их на область лопаток, затем на переднюю поверхность грудной клетки.

Распространенные вопросы

Как часто можно ставить? Не более 1 раза в сутки. Увеличение кратности процедур нецелесообразно, так как не ведет к значимому усилению эффекта.

Сколько дней проводить лечение? Не более 4-5. Более длительная терапия чревата посещением дерматолога в связи с сильным раздражением кожи.

Можно ли обойтись только горчичниками? Нельзя. Это вспомогательный метод, который бесполезен в качестве самостоятельной меры.

Куда ставить ребенку? Как правильно?

Основные подготовительные действия мало отличаются от стандартных. Не накладывать на позвоночник, область сердца. Места установки – область лопаток, под ключицами.

Нельзя ставить на несколько зон одновременно. В один день можно наклеить на спину, а в другой – под ключицы.

Горчичники при бронхите у детей допустимо устанавливать на ноги. Например, на область икроножных мышц.

Как правильно держать по времени? Процедура может длиться 2-5, но не более 10 минут.

Главный ориентир, который говорит об окончании процедуры – появление стойкой гиперемии. Контроль при наложении аппликаций детям должен проводиться каждые 1-1,5 минуты. За ребенком необходимо постоянно следить, так как он может прикоснуться к порошку, а затем начать чесать глаза.

Мнение педиатров

Е.О. Комаровский скептически относится к горчичным аппликациям, обертываниям и ваннам. Он считает, что в лечении воспаления бронхиального дерева лучше прибегнуть к более действенным терапевтическим методам.

Лучше вовремя показать ребенка педиатру, чем самостоятельно делать горчичники при бронхите, игнорируя базовые меры.

Как считает доктор Комаровский, они не способны самостоятельно вылечить ни одну серьезную патологию. А если и помогли, то болезнь изначально можно было бы ликвидировать без аппликаций.

В помощь родителям:

Можно ли беременным горчичники при бронхите?

Не проведено ни одного официального исследования по безопасности рассматриваемого средства при беременности. По этой причине от него лучше отказаться, как минимум, в 1 триместре вынашивания.

Можно или нет использовать горчицу на поздних сроках? Для большей безопасности рекомендовано воздержаться от нее на весь период беременности. Это не настолько необходимый метод лечения, чтобы подвергать плод необоснованному риску.

При малейших симптомах дыхательной патологии лучше сразу обратиться к доктору. Он поможет подобрать терапевтическую схему с препаратами, разрешенными при вынашивании.

Чем заменить горчичники при бронхите?

Альтернативой способны служить другие согревающие и местнораздражающие препараты. Это могут быть не только пластыри, но и бальзамы.

Гель «Горчичный форте»

Заявлен производителем как безопасный аналог. В состав входит не только горчица, но и другие компоненты. Местное раздражающее действие усиливает стручковый перец.

Включает эфирные масла лаванды и шалфея. Они уменьшают раздражающее влияние остальных компонентов.

Содержит эфирное масло эвкалипта. По этой причине им следует с осторожностью прогреваться при склонности к бронхоспазму.

Правила использования относительно просты: гель наносят на кожу массажными движениями, затем утепляют соответствующую область. Согревающее действие сохраняется до 8 часов. Не требует смывания.
[ads-pc-1][ads-mob-1]

Перцовый пластырь

Оказывает местное отвлекающее, раздражающее действие. Помимо густого перца содержит экстракт белладонны. Она обладает легким спазмолитическим эффектом.

Кроме того, включает арнику, каучук, ланолин. Обладает специфическим запахом благодаря сосновой канифоли.

Накладывается на сухую кожу, которую предварительно обезжиривают. Это можно сделать спиртом, одеколоном.

Важное отличие – пластырь можно не снимать в течение 2-х суток. При сильном жжении кожу обрабатывают вазелином.

Компрессы

Можно ставить горчичники при бронхите, а можно их заменить на компрессы. Они обладают более выраженным прогревающим и менее отчетливым раздражающим эффектом. Бывают сухими и влажными.

Наиболее популярный влажный компресс при респираторных заболеваниях – это спиртовой. О чем важно знать при установке? Он абсолютно противопоказан маленьким детям.

Более безопасной альтернативой служат сухие компрессы. Одним из таких является солевой.

Для его изготовления на сковороде нагревают поваренную соль. Ее засыпают в тканевой мешочек, затем прикладывают к нужной области. Важно следить за тем, чтобы соль не была слишком горячей.

Еще народные средства:

Банки: хорошая ли альтернатива?

Некоторые пациенты думают, что лучше ставить банки. Это заблуждение.

Считается, что за счет эффекта вакуума возникает резкое увеличение местного кровотока. Это приводит к повреждению микрососудов. Теоретически результатом должна стать активация иммунитета.

На самом деле положительный эффект от банок так и остался на уровне предположений и рассуждений. Наоборот, их установка ведет к нарушению трофики окружающих тканей. В тяжелых случаях это провоцирует некроз в местах наложения банок.

Заключение

Использовать местно горчицу при кашле и бронхите можно, но не обязательно. Она не служит полноценной альтернативой этиотропной терапии, которая может понадобиться, например, при присоединении бактериальных осложнений.

Единственная обоснованная область применения – это период выздоровления, когда нужно быстрее избавиться от остаточных явлений. Если вред превышает потенциальную пользу, то лучше отказаться от этого устаревшего метода.

Поделитесь с друзьями

Оцените статью:

Загрузка…

Горчичники при кашле

Такой всем известный «бабушкин» способ лечения, как горчичники, лучше всего применять при первых же признаках простуды, осложненных кашлем.

Горчичники обладают хорошим прогревающим и сосудорасширяющим эффектом, во время этой процедуры усиливается кровообращение, улучшается доставка кислорода к тканям легких. Горчичники можно ставить и при застарелом кашле, чтобы ликвидировать застойные явления в легких. В результате процесс отхождения мокроты заметно ускоряется, больному становится легче дышать.

Врачи считают, что горчичники нецелесообразно применять, если заболевание вызвано вирусной инфекцией. Кроме того, «жгучие картонки» не рекомендуется применять беременным и кормящим женщинам, а также маленьким детям. Применение горчичников может негативно повлиять на ход беременности и даже вызвать ее прерывание.

У маленьких же детей слишком тонкая и нежная кожа, применение горчичников может вызвать боль и ожог.

Запомните! Горчичники и другие прогревающие средства нельзя применять при высокой температуре, ознобе и лихорадке, это даст слишком большую нагрузку на сердце. Лучше подождать, пока температура спадет. Их нельзя прикладывать на область сердца, почек, костные выступы, а также на молочные железы. Обратите внимание, что кожа на месте расположения горчичников не должна содержать прыщиков, воспаленных участков, царапин и родинок.

Горчичники не надо ставить слишком часто, максимум 4 дня подряд. Если такой способ лечения не приносит видимых результатов, лучше применить другой метод борьбы с кашлем.

Куда же лучше всего ставить горчичники, чтобы лечение принесло результат? Чаще всего горчичники при кашле ставят на грудь и верхнюю часть спины, располагая их между лопатками и под ними. Также можно наложить горчичники на ступни ног и на икры, надев для лучшего эффекта теплые шерстяные носки.

До проведения процедуры убедитесь, что срок годности горчичников не кончился. Горчица не должна осыпаться. Поместите горчичники в неглубокую миску с умеренно горячей водой, несколько секунд подержите и сразу приложите их к коже больного. Укройте больного махровым полотенцем и одеялом.

Еще один полезный совет – не надо слишком долго держать горчичники на теле, пользы от этого не прибавится, а вот ожог можно получить. Максимальное время этой процедуры – 15-25 минут, но можно подержать горчичники и 5-10 минут. Если больной жалуется на дискомфорт, лучше сразу же снять горчичники.

После процедуры аккуратно уберите остатки горчицы с кожи больного чистым полотенцем. При сильном покраснении можно смазать кожу маслом. После процедуры больному лучше не вставать и не выходить из комнаты, поэтому горчичники обычно ставят перед сном. Для лучшего прогревающего эффекта дайте больному выпить чая с малиной или молока с маслом и медом.

Читайте также:
Кашель
Сухой кашель
Средство от кашля
Сильный кашель
Как лечить кашель
Народное лечение кашля
Кашель с температурой
Кашель без температуры
Кашель при беременности
Насморк и кашель
Ингаляции при кашле
Мокрый кашель
Кашель с мокротой
Если не проходит кашель
Причины кашля
Лающий кашель
Боли в теле при кашле
Кашель после операции
Аллергический кашель
Виды кашля
Таблетки от кашля
Отхаркивающий кашель
Антибиотики при кашле
Лечение сухого кашля
Сухое горло и кашель
Боли в горле при сильном кашле
Как лечить сильный кашель
Как лечить аллергический кашель
Клиника лечения кашля
Куда обращаться при кашле
Противопоказания при кашле
Горчичники при кашле
Небулайзер при кашле
Кровь при кашле
Кашель с кровью, причины
Хронический кашель, причины
Лечение хронического кашля
Тяжело дышать
Почему тяжело дышать
Не хватает воздуха
Тяжело стало дышать
Тяжело дышать, причины
Ночью тяжело дышать

Куда ставить при кашле горчичник 🚩 горчичники взрослым 🚩 Лечение болезней

Как действуют горчичники

Горчичники – бумажные листы небольшого размера, с одной стороны покрытые сухой смесью муки и порошка из семян горчицы. Их ставят взрослым и детям, когда необходимо прогреть внутренние органы при кашле, вызванным простудой, трахеитом, хроническим бронхитом или пневмонией. Их назначают и в тех случаях, когда нужно избавиться от сухого кашля, чтобы облегчить отход мокроты.

Горчичник размачивают непродолжительное время в теплой воде и накладывают на тело. Под действием воды горчица начинает выделять эфирные масла, они вызывают раздражение верхнего слоя кожи и расширение кровеносных сосудов, расположенных под ним. Расширение сосудов, в свою очередь, усиливает кровообращение в тех органах, которые расположены под горчичником.

Детям горчичники могут быть назначены только после того, как исполнился 1 год.

Как правильно ставить горчичники

Ставить горчичник необходимо на зону проекции пораженного органа. Если причиной кашля является воспаление легких – пневмония или бронхит, горчичники нужно ставить на верхнюю часть грудной клетки или на спину. Ни в коем случае нельзя накладывать горчичник на область, под которой расположено сердце, а также на позвоночник. Горчичники нельзя использовать для лечения вирусных заболеваний, которые, как правило, сопровождаются повышением температуры. Их также нельзя ставить в тех случаях, когда температура тела больного превышает 37оС.

Горчичники противопоказаны, если у пациента имеются аллергические реакции. Их нельзя ставить в случае, когда есть заболевания кожи или рубцы на ней. К противопоказаниям относится бронхиальная астма и опухолевые заболевания.

Конечно, если взрослый человек понимает, что раздражение, вызванное горчичником, оказывает целительный эффект, он сможет мужественно вытерпеть положенные 10 минут. Однако для маленького ребенка они могут показаться вечностью, поэтому малышам горчичники ставят поверх куска марли, положенной на грудь и спину, это облегчит болевые ощущения. Время процедуры зависит от возраста пациента. Ребенку до 3-х лет горчичники ставят на 2 минуты, в возрасте 3-7 лет держать их нужно 3-4 минуты, в возрасте 7-12 – 5-6 минут. Не стоит настаивать, если ребенок жалуется, что ему сильно печет кожу, снимите горчичник и удалите остатки горчицы влажной салфеткой. У взрослого человека снимать горчичники следует после того, как кожа под ними покраснеет, но нельзя держать их более 15 минут. Место покраснения можно затем обработать питательным кремом, чтобы снять раздражение.

Использование горчичников от кашля или простуды — Heilen Natural Medicine

В этом году многие люди страдают от кашля и простуды. Горчичный пластырь — это простое домашнее средство, которое можно использовать, чтобы уменьшить заложенность носа, открыть легкие и облегчить кашель или простуду в груди. Вот инструкции, как его сделать. Ниже есть видео с демонстрацией.

Необходимые материалы

  • Сухой горчичный порошок (можно найти в разделе специй в вашем местном продуктовом магазине)
  • Мука
  • Маленькая миска или контейнер для смешивания
  • Ложка
  • Вода
  • Полотенце для рук

Указания

  • Положите чистое полотенце для рук на ровную поверхность.
  • Смешайте 1 часть сухого горчичного порошка с 2-4 частями муки в небольшой миске или контейнере.
  • Медленно добавьте небольшое количество теплой воды к сухим ингредиентам и перемешайте ложкой.Продолжайте добавлять воду, пока не получите густую консистенцию пасты.
  • Нанесите горчичную пасту на половину полотенца для рук.
  • Сложите полотенце пополам, чтобы получился «бутерброд с горчицей». Сложите так, чтобы паста не открывалась.
  • Положите полотенце на обнаженную грудь, следя за тем, чтобы горчичная паста не контактировала напрямую с кожей.
  • Установите таймер на пять минут и проверьте кожу на груди через пять минут. Вы должны увидеть некоторое покраснение и почувствовать тепло на коже.
  • Положите полотенце на кожу и установите другой таймер на 10-15 минут.
  • Уберите полотенце, когда таймер отключится.

Предостережения и рекомендации

  • Риски для этого лечения включают образование волдырей на коже, если горчичная паста попадает в прямой контакт с кожей или если лечение продолжается слишком долго.
  • Оставьте горчичник на груди максимум на 20 минут на одну процедуру
  • Вы можете повторять эту процедуру до трех раз в день
  • Обязательно установите таймер и никогда не засыпайте с полотенцем на груди
  • Это лечение безопасно для детей и взрослых
  • Избегайте наложения на открытые раны, язвы или незаживающие хирургические разрезы

Вот короткое видео с демонстрацией.Качество видео оставляет желать лучшего, поэтому мы скоро создадим свою версию и заменим ее на нашу.

Старожилы лекарство от кашля и простуды: горчичный пластырь

На протяжении веков горчичники были надежным домашним средством от гриппа, кашля, простуды, пневмонии и многих других болезней. Его использовали регулярно до недавнего времени, так как считалось, что эта припарка изгоняет все «недуги» тела.

По мере появления на рынке более приятных лекарств популярность припарок снижалась.

Это лечение может быть неудобным (из-за тепла, которое оно генерирует), но считалось, что оно отбрасывает разум обратно в тело и хорошо справляется с вытяжкой всего «гнилого» гриппа и застойных явлений.

Это не стопроцентно гарантированное лекарство, но ИМХО, это одна серьезная гангстерская ошибка, которая рассмешит одного из этих плохих парней.

Если вы когда-нибудь задумывались, как их делают и как их использовать, вот старый рецепт, который у меня был в течение многих лет …

Горчичный пластырь

4 столовые ложки муки
2 столовые ложки сухой горчицы
Вода (теплая)

Проезд :

  • Смешайте сухие ингредиенты, затем добавьте воду, чтобы получилась паста.Паста должна быть гладкой и легко растекающейся, но не слишком жидкой, чтобы она не растекалась или становилась водянистой.
  • Возьмите чистое полотенце из мешка из-под муки и равномерно распределите пасту по верхней половине (только с одной стороны), сложите нижнюю половину полотенца и нанесите на область груди. Не наносите пасту прямо на кожу, это может вызвать образование пузырей. Накройте чистым полотенцем, а затем накройте плотным одеялом, чтобы стимулировать потоотделение (свежее полотенце защищает одеяло от любых пятен). Если вам нужна припарка большого размера, накройте пастой все полотенце из мешка с мукой, а затем накройте еще одним полотенцем из мешка (или сделайте два отдельных).
  • Оставить пластырь на 20 минут, удалить, если кожа станет темно-красной и существует опасность образования пузырей. При использовании на детях внимательно следите за нежной кожей (не использовать на детях младше школьного возраста, если не назначил врач). Некоторое покраснение является нормальным, так как тепло и циркуляция отводятся к поверхности.
  • Удалите припарку, промойте кожу теплой тканью, чтобы удалить все просочившиеся следы, высушите и нанесите на кожу слой сала или вазелина.
  • Затем нанесите на спину на такое же количество времени или до появления опасности образования пузырей, снова накрыв тяжелым одеялом и следуя описанной выше процедуре.
  • При необходимости можно наносить повторно каждые 4–6 часов.
  • Теплая ванна или душ могут немного успокоить пациента после лечения, но они должны постоянно находиться под присмотром из-за их ослабленного от болезни состояния (не оставлять одного ни на минуту). Это стандартная помощь во всех случаях болезни.

Советы :

  • Я видел несколько рецептов, в которых рекомендуется наносить слой вазелина на кожу перед нанесением припарки, это, по-видимому, помогает предотвратить образование пузырей… однако все же «подглядывайте» на кожу каждые несколько минут, чтобы наблюдать.Также считается, что использование яичного белка вместо воды для смешивания пасты дает некоторую защиту от образования пузырей.
  • Полотенца из муки — это кухонное полотенце из хлопка. Если у вас их нет, вы можете нанести эту пасту на майку или другую тонкую ткань, например, байковую. Для детей можно использовать хлопковое махровое полотенце.
  • Соотношение ингредиентов можно отрегулировать, если необходимо, чтобы приспособиться к более низким уровням переносимости (это может вызвать дискомфорт), но помните, что цель состоит в том, чтобы вывести тепло (и болезнь) на поверхность.
  • Это не шутка — ведь нужно следить за волдырями, особенно на нежной коже. Не засыпайте с этим включенным — установите будильник, если вы лечите себя (на 5-минутные интервалы).
  • Наряду с простудой и гриппом они также широко использовались для лечения боли в мышцах, артрита, боли в спине, плохого кровообращения и подагры (и многих других вещей, я уверен). Просто нанесите на пораженный участок.

Горчичный пластырь своими руками при бронхите, кашле, простуде, заложенности груди и фурункулах

Горчичный пластырь обладает удивительной пользой для здоровья, хотя он в основном используется при проблемах, связанных с простудой и кашлем, у него есть и другие применения.Хотя вы можете использовать горчичный порошок, купленный в магазине, я предпочитаю использовать горчичный порошок собственного приготовления, так как он наиболее эффективен. Если вы используете купленный в магазине горчичный порошок, обязательно используйте его из упаковки, которую вы недавно открыли.

Чтобы приготовить горчичник, сначала измельчите горчицу до мелкого порошка в сухой банке. Добавьте указанное количество муки в горчичный порошок и хорошо перемешайте с водой до образования густой пасты. Возьмите плотную ткань и нанесите на нее горчичную пасту. Теперь нанесите тонкий слой кокосового или оливкового масла на кожу, чтобы наложить пластырь.

Нанесите пластырь на тонкий слой масла и накройте горячим влажным полотенцем. Снимите пластырь через 20–30 минут, как только полотенце утихнет. Если у вас очень чувствительная кожа, накройте горчичную пасту другой тонкой тканью, а затем нанесите на кожу. Не забывайте периодически проверять кожу на предмет покраснения или раздражения, особенно если вы используете его впервые.

Горчичный гипс Преимущества:

1.При заложенности грудной клетки и бронхите:

Он веками использовался для лечения заложенности грудной клетки. Это очень эффективное домашнее средство, которое можно применять как взрослым, так и детям. Когда мы простужаемся и грипп, основная проблема — это мокрота, многим из нас трудно откашлять мокроту.

Наложение горчичника на грудь очень помогает вывести мокроту.

Горчица усиливает кровообращение и нагревает область, на которую ее наносят, тем самым помогая вывести мокроту.Многие боятся накладывать горчичники из-за ожогов, но наносить горчицу, как показано в этом рецепте, очень безопасно.

2. Для фурункулов:

Горчичный пластырь — эффективный способ уменьшить инфекцию и быстро вылечить фурункулы. Нанесите горчичный пластырь на фурункулы, чтобы они созрели и быстро высохли.

3. При лихорадке:

Горчичники согревают тело и вызывают потоотделение, снижая температуру тела.

4. При артрите:

Так как горчица обладает противовоспалительными свойствами, наложение теплого пластыря на суставы очень помогает облегчить боль.

5. Для Детокса:

Горчичники известны своей эффективностью по выведению токсинов из организма.

Как сделать горчичный гипс:

МЕТОД:
1. Возьмите семена горчицы и измельчите их в ступке пестиком до мелкого порошка.

2. Добавить муку в измельченные семена горчицы и смешать до состояния пасты с небольшим количеством теплой воды. Паста не должна быть ни слишком густой, ни слишком жидкой.

3. Возьмите кусок хлопчатобумажной ткани и простерилизуйте его, кипятя в воде, а затем полностью отожмите воду. Нанесите на ткань тонкий слой горчичной пасты.

4. Нанесите тонкий слой кокосового или оливкового масла, а затем нанесите горчичный пластырь на грудь и спину.Накройте теплым влажным полотенцем и подождите 15 минут, прежде чем снимать горчичник, а затем промойте участок теплой водой. Для демонстрации наложила на руки гипс…

ПРИМЕЧАНИЯ:

  • Если вы чувствуете, что кожа горит, снимите пластырь и промойте пораженное место водой. Но это случается только с людьми с очень чувствительной кожей.
  • Я использую его непосредственно на своей коже.
  • Я использовал соотношение 1: 4 для горчичного порошка и муки, вы также можете увеличить соотношение до 1: 5.
  • Я использовала цельнозерновую муку, вы можете использовать любую муку, которая есть у вас дома.
  • Поскольку мы добавляем муку, а затем наносим на нее тонкий слой масла, этот пластырь очень безопасен для детей.

Горчичный пластырь для лечения кашля, простуды и пневмонии

Гиппократ, отец медицины, первым представил и применил то, что мы называем горчичником

. Семена горчицы, как традиционное растение, на протяжении тысячелетий использовались для лечения респираторных заболеваний, а также ревматизма (артрита и болей в суставах).Хотя и не считается «современным лекарством», горчичник очень хорошо работает при таких состояниях, как пневмония, легочные инфекции, кашель, бронхит, простуда и грипп. Он действует как «противодействующий раздражитель», который в основном действует, вызывая некоторое раздражение кожи над обрабатываемой областью (например, легких), притягивает кровь и усиливает кровообращение в этой области. Преимущество использования горчичника при заболеваниях, связанных с легкими, заключается в том, что он помогает расщеплять и убирать заложенность, выводит токсины, облегчает кашель и стимулирует иммунную систему на борьбу с инфекциями.При местном применении (нанесении на кожу) горчичник не только эффективен, но и быстр, безопасен, недорог и прост в изготовлении.

Ниже приведены инструкции, как сделать горчичник.

Товаров для горчичников:

Горчичный порошок, универсальная мука, теплая вода, кухонное полотенце, шерстяное одеяло или банное полотенце, салфетка для лица, кокосовое или оливковое масло.

  1. В небольшой миске смешайте 1 часть (4 столовые ложки) горчичного порошка с 1 частью (4 столовые ложки) универсальной муки.
  2. Добавьте теплую (не горячую) воду в смесь, пока она не превратится в жидкую пасту (похожую на тесто для блинов).
  3. Разложите кухонное полотенце на твердой поверхности.
  4. Распределите пасту ложкой на 1/4 кухонного полотенца (разделите кухонное полотенце на 4 равные части) или на участок на полотенце, который будет покрывать обрабатываемую область, необходимую на человеке (т. Е. Достаточную площадь, чтобы покрыть грудь человека, которого лечат).
  5. Сложите полотенце пополам, а затем еще раз пополам, чтобы покрыть горчичную штукатурку.Слегка сложите полотенце по бокам, чтобы не просочилась горчичная смесь.
  6. Нанесите кокосовое или оливковое масло на участок кожи, на который будет наложен горчичный пластырь. * Это очень важно, чтобы избежать ожога или образования пузырей на коже от пластыря.
  7. Лягте и оберните сложенное горчичное полотенце вокруг обрабатываемой области. Убедитесь, что смесь горчичного пластыря лежит как можно ближе к коже, а не на сторону кухонного полотенца, сложенного в несколько слоев.
  8. Накройте горчичник шерстяным одеялом или банным полотенцем, чтобы удержать тепло и тепло в этой области.
  9. В этот момент, в течение нескольких минут, кожа начнет ощущаться горячей, «колючей» и «красной». Это ожидаемая реакция, которую горчичник будет оказывать на кожу, чтобы создать свое лечебное действие.
  10. * Поднимайте горчичник каждые 1-2 минуты, чтобы на коже не образовывались пузыри. Опять же, цель пластыря — вызвать тепло, кровь и покраснение на поверхность кожи.При этом важно убедиться, что гипс не обжигает и не оставляет пузырей на коже.
  11. Продолжайте проверять кожу каждые пару минут, удерживая нанесение на коже в течение 15 минут, но не более 20 минут.
  12. После завершения снимите горчичный пластырь и тщательно смойте оставшееся масло с обработанного участка влажной салфеткой для лица, чтобы убедиться, что все горчичное масло полностью удалено и не вызывает ожогов кожи после обработки.
  13. При необходимости повторите наложение горчичника на спину (на легкие).

Важно помнить:

Это мощное лекарственное средство для лечения заболеваний легких, поэтому оно подействует.

Горчичный пластырь может вызвать ожог или образование пузырей, если он будет слишком сильным или если оставить его слишком долго. Убедитесь, что вы не спите во время лечения, попросите кого-нибудь следить за вами или установите будильник, чтобы вы не заснули с горчичником на коже.

Если вы сомневаетесь, измените начальную пропорцию обработки с 1: 1 горчичного порошка на универсальную муку до 1: 2 (2 столовые ложки горчичного порошка на 4 столовые ложки универсальной муки), затем увеличивайте до 1: 1.

Для маленьких детей, маленьких детей, которые не могут объяснить, как пластырь ощущается на их коже, для тех, кто очень слаб, или для тех, кто не может определить температуру на коже, вы можете добавить дополнительное кухонное полотенце (сложенное половина) между кожей и горчичником.

Кожа может оставаться красной в течение нескольких часов после процедуры.

Для достижения наилучших результатов повторяйте каждые 4-6 часов (или, по крайней мере, 1 раз в день в течение 3 дней подряд), желательно вечером перед сном, а затем примите горячую ванну или душ и расслабьтесь.

Вы успешно подписались!

A TAS2R38 рецептор-зависимый иммуномодулятор на стыке между персонализированной медициной и питанием

Front Immunol. 2021; 12: 669005.

,
1
,
1
,
1
,
2
,
2
,
3
,
3
,
2
,
4
и
1
,

*

Хоай Т.Т. Тран

1
Молекулярная профилактическая медицина, Университетский медицинский центр и медицинский факультет Фрайбургского университета, Фрайбург, Германия,

Ребекка Стеттер

1
Молекулярная профилактическая медицина, Университетский медицинский центр и медицинский факультет Фрайбургского университета, Фрайбург, Германия,

Коринна Херц

1
Молекулярная профилактическая медицина, Университетский медицинский центр и медицинский факультет Фрайбургского университета, Фрайбург, Германия,

Дженни Спёттель

2
Институт пищевых технологий и пищевой химии, Берлинский технический университет, Берлин, Германия,

Марейке Крелл

2
Институт пищевых технологий и пищевой химии, Берлинский технический университет, Берлин, Германия,

Франциска С.Hanschen

3
Качество растений и продовольственная безопасность, Институт овощных и декоративных культур им. Лейбница, Гросберен, Германия,

Моника Шрайнер

3
Качество растений и продовольственная безопасность, Институт овощных и декоративных культур им. Лейбница, Гросберен, Германия,

Саша Рон

2
Институт пищевых технологий и пищевой химии, Берлинский технический университет, Берлин, Германия,

Майк Беренс

4
Раздел II: Метаболическая функция, хеморецепция и биосигналы, Институт биологии пищевых систем им. Лейбница при Мюнхенском техническом университете, Фрайзинг, Германия,

Эвелин Лами

1
Молекулярная профилактическая медицина, Университетский медицинский центр и медицинский факультет Фрайбургского университета, Фрайбург, Германия,

1
Молекулярная профилактическая медицина, Университетский медицинский центр и медицинский факультет Фрайбургского университета, Фрайбург, Германия,

2
Институт пищевых технологий и пищевой химии, Берлинский технический университет, Берлин, Германия,

3
Качество растений и продовольственная безопасность, Институт овощных и декоративных культур им. Лейбница, Гросберен, Германия,

4
Раздел II: Метаболическая функция, хеморецепция и биосигналы, Институт биологии пищевых систем им. Лейбница при Мюнхенском техническом университете, Фрайзинг, Германия,

Отредактировал: Гарри Уичерс, Университет и исследования Вагенингена, Нидерланды

Рецензент: Даниэль Рене Рид, Центр химических чувств Монелла, США; Такуми Мисака, Токийский университет, Япония

Эта статья была отправлена ​​в Nutritional Immunology, раздел журнала Frontiers in Immunology

Поступила в редакцию 18 февраля 2021 г .; Принята в печать 29 марта 2021 года.

Copyright © 2021 Tran, Stetter, Herz, Spöttel, Krell, Hanschen, Schreiner, Rohn, Behrens and Lamy

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Заявление о доступности данных

Исходные материалы, представленные в исследовании, включены в статью / дополнительные материалы. Дальнейшие запросы можно направить соответствующему автору.

Реферат

Понимание индивидуальной реакции на питание и лекарства приобретает все больший интерес и важность. Имеются данные о том, что различия в генах рецепторов горького вкуса (TAS2R), которые дают начало двум частым гаплотипам, TAS2R38-PAV (функциональный) и TAS2R38-AVI (нефункциональный), могут влиять на индивидуальные различия в состоянии здоровья.Здесь мы проанализировали значимость рецептора TAS2R38 в регуляции иммунного ответа человека с использованием аллилизотиоцианата, агониста TAS2R38 (AITC) из растений Brassica . Дифференциальный ответ в мобилизации кальция на лечение AITC в лейкоцитах здоровых людей подтвердил актуальность функциональности TAS2R38, независимо от активации катионного канала TRPV1 или TRPA1. Мы также идентифицировали TAS2R38-зависимость сигнальной активности MAPK и AKT, бактерицидную (токсичность в отношении E.coli ) и противовоспалительная активность (ингибирование TNF-альфа при стимуляции клеток). Эти результаты in vitro были получены при соответствующих уровнях в плазме крови человека в низком микромолярном диапазоне, как показано здесь в исследовании вмешательства человека с пищей, содержащей AITC.

Ключевые слова: Растения Brassica , Brassicaceae, изотиоцианаты, рецептор горького вкуса человека (TAS2R), TAS2R38, персонализированное (точное) питание, прецизионная медицина, прецизионное здоровье

Введение

В качестве важной составляющей точной медицины точность Питание направлено на разработку индивидуальных подходов к питанию для укрепления и поддержания здоровья и предотвращения заболеваний.Стратегии рассматривают дифференцированные реакции на определенные индивидуализированные питательные вещества пищевого происхождения, возникающие из-за взаимодействия между питательными веществами и биологическими процессами. Восприятие вкуса считается важным фактором для изменения пищевого поведения и, как следствие, риска для здоровья и болезней (1). Горечь — один из ключевых атрибутов растений из отряда Brassicales. Считается, что этот вкус опосредован взаимодействием фитохимического класса глюкозинолатов (GLS) и их продуктов разложения мирозиназы изотиоцианатов (ITC) с рецептором горького вкуса TAS2R38, связанным с G-белком, на языке (2).У людей горький вкус воспринимается семейством из 25 различных вкусовых рецепторов (TAS2R), экспрессируемых на клетках вкусовых рецепторов типа II во вкусовых сосочках (3-5). Было обнаружено, что TAS2R38 довольно специфично реагирует на соединения, содержащие тиомочевину [-NH- (C = S) -NH-] или ITC (N = C = S) фрагмент (6, 7). К настоящему времени обнаружено, что рецептор TAS2R38 экспрессируется во многих различных экстрагустационных тканях, но его физиологическое значение в них все еще является предметом многочисленных дискуссий. Экспрессия белка TAS2R38 была недавно обнаружена в периферических иммунных клетках (нейтрофилах, моноцитах и ​​лимфоцитах) (8-10).Что делает рецептор особенно интересным в контексте точной медицины / питания, так это частые однонуклеотидные полиморфизмы (SNP) в гене TAS2R38 человека. Эти SNP вызывают аминокислотные замены, в результате которых образуются два общих гаплотипа: функциональный (пролин-аланин-валин, PAV) и нефункциональный (аланин-валин-изолейцин, AVI) (11). Фактически, почти во всех популяциях людей во всем мире эти два аллеля встречаются с высокой частотой (12), и, как правило, от 25 до 30% населения не являются дегустаторами (13).Синигрин и его продукт GLS-мирозиназа аллил ITC (AITC) являются одними из самых распространенных фитохимических веществ в Brassicaceae (14). Сообщается, что присутствие этих соединений способствует горькому и острому вкусу у овощей Brassica (14, 15), а дегустационные и не дегустирующие гаплотипы TAS2R38 здесь хорошо коррелируют с горькой чувствительностью людей к растениям Brassica (2 ). Например, синигрин был связан с горьким вкусом вареной брюссельской капусты и цветной капусты (16, 17).Было показано, что люди с диплотипом PAV / PAV оценивают интенсивность горечи у овощей Brassicaceae значительно выше, чем у овощей с AVI / AVI (2).

Исследования функциональной экспрессии в клетках HEK293T-Gα16gust44, временно трансфицированных 25 предположительно функциональными ATS2R, показали, что как синигрин, так и AITC избирательно запускали дегустационный вариант рецептора TAS2R38 (18). Wu et al. (19) позже подтвердили свои наблюдения с помощью биосенсора на основе рецептора TAS2R38.AITC известен своим укрепляющим здоровье потенциалом, включая противовоспалительную и иммуномодулирующую способность (20–23). Синигрин / корень хрена, содержащий AITC ( Armoracia rusticana ), используется в фармакологических средствах для лечения воспалительных заболеваний, включая острый синусит, бронхит и инфекции мочевыводящих путей (24, 25). В целом ITC представляют собой известные многоцелевые соединения, взаимодействующие с широким спектром сигнальных путей и молекул (20). Связан ли иммунный ответ, запускаемый AITC, с взаимодействием TAS2R38, до сих пор не исследовано.

Недавние открытия предполагают, что функциональный TAS2R38 имеет отношение к респираторному врожденному иммунитету (26) и предлагается в качестве фактора местной защиты хозяина (27). Дополнительную поддержку этому предоставили Lee et al. (28). В их исследовании было обнаружено, что TAS2R38 играет роль в хроническом риносинусите и обнаружении бактерий. Повышенная предрасположенность к хроническому риносинуситу также связана с нефункциональным (AVI / AVI) диплотипом (28). Нефункциональный диплотип связан у пациентов с муковисцидозом с более тяжелыми симптомами (29), он связан с повышенным риском кариеса (30), повышенным риском колоректального (31) и желудочного (32) рака.

В настоящем исследовании изучали влияние AITC на врожденную и адаптивную иммунную систему человека в зависимости от функционального статуса рецептора TAS2R38. После обработки AITC в субпопуляциях периферической крови человека (PBMC) были обнаружены различные эффекты мобилизации кальция как параметра для активации рецептора, сопряженного с G-белком (GPCR), что дало первые свидетельства функционального взаимодействия рецептора TAS2R38. На основании этих результатов здесь были исследованы дополнительные параметры, со стимулами врожденного и адаптивного иммунного ответа и без них.Селективный бактерицидный потенциал иммунных клеток от функциональных доноров TAS2R38 был продемонстрирован с использованием бактерий E. coli K12 после обработки AITC.

Материалы и методы

Химические вещества

Фетальная телячья сыворотка (FCS), L-глутамин и физиологический раствор с фосфатным буфером (PBS, без Ca и Mg), раствор пенициллин-стрептомицина (P / S), RPMI-1640 и DMEM без фенола красные были от Life Technologies (Дармштадт, Германия). Сбалансированный солевой раствор Хэнка (HBSS) был от PAA Laboratories GmBH (Coelbe, Германия).β-Меркаптоэтанол был приобретен у Fluka (Buchs, Швейцария). Диметилсульфоксид (ДМСО; чистота> 99%) был приобретен у Applichem GmbH (Дармштадт, Германия). Вода, не содержащая нуклеаз, была от Qiagen (Hilden, Германия). LymphoPrep ™ был от Alere Technologies AS (Осло, Норвегия). Иономицин (чистота ≥98%), S -Nitroso- N -Ацетил-D (SNAP), карбокси-PTIO (cPTIO), капсазепин и A-967079 были из Cayman Europe (Ann Arbor, Michigan, USA), U73122 был приобретен у Enzo Life Sciences (Лёррах, Германия).AITC, твин-20, стандартный белок BSA, персульфат аммония и липополисахарид (LPS, из Escherichia coli O11: B4) были получены от Sigma-Aldrich (Тауфкирхен, Германия). Очищенные антитела функционального класса против CD3 и CD28 человека были получены от eBioscience Affymetrix (Франкфурт, Германия). DAF-FM диацетат, флуо-4-AM и Pluronic ™ F-127 были от Thermo Fisher Scientific GmBH (Дармштадт, Германия). DiBAC 4 (3) (Бис- (1,3-дибутилбарбитуровая кислота) триметиноксонол) был получен от Biomol (Гамбург, Германия).ЭДТА (99%, год) приобретали в Serva GmbH (Гейдельберг, Германия). Нитроцеллюлозные мембраны Amersham ™ ECL Select ™ и Hybond ECL были получены от Ge Healthcare Biosciences AB (Упсала, Швеция), реагент Quick Start Bradford 1x Dye Reagent был от BioRad Laboratories GmbH (Мюнхен, Германия) и Page Ruler Plus Prestained Protein Ladder от Thermo Fisher Scientific (Уолтем, Массачусетс, США). Для иммуноблоттинга использовали следующие первичные антитела: анти-p-ERK1 / 2 (Thr202 / Tyr204, 1: 500), анти-ERK1 / 2 (1: 2000, клон L34F12), анти-p-p38 (Thr180 / Tyr182, 1: 2000), анти-p-Akt (1: 2000, Ser 473, клон D9E), анти-Akt (1: 1000) от Cell Signaling (Дэнверс, Массачусетс, США) и анти-бета-актин (1: 10000, клон AC-74) от Sigma-Aldrich Chemie GmbH (Тауфкирхен, Германия).Вторичные антитела против мыши и кролика, меченные пероксидазой хрена (HRP), были приобретены в Cell Signaling (Danvers, Massachusetts, USA). Муравьиная кислота (FA; 98%) и ацетонитрил (ACN, качество для ультра ЖХ-МС) были приобретены у Carl Roth GmbH Co. KG (Карлсруэ, Германия). Трифторуксусная кислота (TFA, 99,9%) была от Carl Roth GmbH Co. KG (Карлсруэ, Германия) и Applichem GmbH (GmbH (Дармштадт, Германия). Картриджи для твердофазной экстракции C18ec (3 мл, 200 мг) были приобретены у Macherey-Nagel GmbH & Co.KG (Дюрен, Германия). Для всех водных растворов использовалась вода качества Milli-Q.

Выделение PBMC человека

PBMC человека выделяли из свежей периферической крови 30 добровольцев в Университетском медицинском центре во Фрайбурге, Германия. Кровь собирали у добровольцев с использованием Li-гепаринизированных вакутейнеров (Sarstedt, Nümbrecht, Германия). Добровольцы (мужчины и женщины в возрасте от 20 до 35 лет) имели нормальный ИМТ, были здоровы и не курили. РВМС выделяли из крови в течение 2 ч центрифугированием в градиенте LymphoPrep ™ (плотность: 1.077 г / см 3 ) при 1200 г в течение 13 мин при комнатной температуре, используя пробирки SepMate ™ на 50 мл (Гренобль, Франция), затем дважды промывали PBS и определяли жизнеспособность и концентрацию клеток с использованием теста исключения трипанового синего. PBMC использовали непосредственно для иммуноокрашивания или культивировали в среде RPMI 1640 с добавлением 10% инактивированной нагреванием FCS, 2 мМ L-глутамина, 100 Ед / мл пенициллина / стрептомицина при 37 ° C в увлажненном инкубаторе с 5% CO 2. /95% воздушная атмосфера. Активацию клеток проводили с использованием функциональных антител к CD3 и CD28 или LPS (контроль растворителя: водный).

Определение полиморфизма гена TAS2R38

ДНК выделяли из 1×10 6 PBMC с использованием мини-набора QIAamp DNA Blood Mini (Qiagen, Hilden, Германия) в соответствии с протоколом производителя. Фрагмент гена TAS2R38 размером 831 п.н. амплифицировали с использованием следующих олигонуклеотидов в указанной конечной концентрации: прямой 5’ACCAATGCCTTCGTTTTCTTGGTGA’3 и обратный 5’CAGCTACCAAGCCATCATCA ‘3 (33). ПЦР-реакцию проводили в общем объеме 50 мкл, содержащем 20 нг ДНК, 1 ед. ДНК-полимеразы Taq (Life Technologies, Дармштадт, Германия), 0.Прямой праймер 5 мкМ и обратный праймер 0,5 мкМ, смесь dNTP по 0,2 мМ каждый (Life Technologies, Дармштадт, Германия), 1,5 мМ MgCl и 1x ПЦР-буфер (Life Technologies, Дармштадт, Германия). Условиями ПЦР были: 94 ° C в течение 3 минут с последующими 30 циклами (94 ° C в течение 45 секунд, 54,2 ° C в течение 45 секунд и 72 ° C в течение 90 секунд) и 72 ° C в течение 10 минут. Продукты ПЦР очищали с использованием набора Monarch PCR & DNA Cleanup Kit (New England Biolabs, Франкфурт-на-Майне, Германия) в соответствии с протоколом производителя. Фрагмент ПЦР секвенировали с использованием ПЦР с обратным праймером 5’CAGCTACCAAGCCATCATCA’3 для анализа SNP в положении 145 гена и прямого праймера 5 ‘GGAAGGCACATGAGGACAAT’3 для анализа SNP в положении 785 и положении 886 с помощью GATC (Констанц, Германия) .Последовательности анализировали с помощью программного обеспечения Chromas 2.6.4 (Technelysium, Южный Брисбен, Австралия). Концентрацию ДНК анализировали с помощью NanoDrop (лаборатория Peq, Эрланген, Германия). 5 мкл смеси для ПЦР использовали для визуализации продукта ПЦР в агарозном электрофорезе.

Calcium Flux Assay

Окрашивание PBMC для измерения кальция выполняли, как описано ранее (10). Каждый образец, содержащий 0,5 × 10 6 клеток, анализировали в течение 800 секунд с использованием проточного цитометра FACSCalibur ™ (BD Biosciences, Гейдельберг, Германия).Через 60 секунд клетки подвергали воздействию тестируемых соединений, а затем измеряли еще в течение 740 секунд. Данные анализировали с помощью программного обеспечения FlowJo (Ashland, Oregon, USA).

Обнаружение оксида азота (NO) с помощью проточной цитометрии

PBMC (0,25×10 6 ) суспендировали в среде DMEM и подвергали контролю растворителя, AITC или 100 мкМ NO-донора SNAP (положительный контроль) в 96-луночных планшеты на 30-270 мин в увлажненном инкубаторе (5% CO 2 , 37 ° C). После этого ячейки были загружены 0.5 мкМ диацетата DAF-FM, приготовленного в буфере HBSS, в течение еще 30 мин. Загрузка DAF-FM при такой низкой концентрации позволяет снизить фоновую флуоресценцию и улучшить отношение сигнал / шум в отдельной ячейке (34). После инкубации клетки дважды промывали PBS, затем 30 мин. деэтерификация внутриклеточных диацетатов в темноте при комнатной температуре. Сигналы флуоресценции (ex 488 нм, em 530 ± 30 нм) контролировали с использованием проточного цитометра FACSCalibur ™. Среднюю интенсивность флуоресценции (MFI) каждого образца рассчитывали с использованием программного обеспечения FlowJo (Ashland, Oregon, USA).DAF-FM-DA имеет предел обнаружения около 5 нМ NO (35).

Бактерицидная активность

E. coli K-12 бактерии выращивали в среде Лурия-Бертани при 37 ° C до средней логарифмической фазы, как определено с помощью OD600. Затем PBMC (1×10 6 / мл) инкубировали с E. coli K-12 при MOI 0,5 в среде RPMI 1640, дополненной 2% инактивированной нагреванием фетальной телячьей сывороткой, и подвергали воздействию тестируемых соединений в течение 120 мин в условия увлажнения (5% CO 2 , 37 ° C).После этого добавляли 1 мкг / мл красителя для мембранного потенциала DiBAC 4 (3) и инкубировали в течение 10 мин при комнатной температуре в темноте. Впоследствии клетки промывали один раз PBS и центрифугировали при 4500 x g в течение 10 мин. Процент деполяризованных бактерий определяли с использованием проточного цитометра FACSCalibur ™ с длиной волны возбуждения 493 нм.

Анализ белков иммуноблоттингом

Представляющие интерес белки анализировали иммуноблоттингом, как описано ранее (36).Денситометрический анализ проводили для количественной оценки иммуноблотов с использованием программного обеспечения Quantity One (Bio-Rad, Мюнхен, Германия) и нормализовали по β-актину.

Количественная оценка высвобождения цитокинов с помощью метода мультиплексных шариков или анализа ELISA

PBMC (1×10 6 / мл), культивированных в среде RPMI 1640 с добавлением 10% инактивированной нагреванием фетальной сыворотки теленка, 2 мМ L-глутамина, 100 Ед / мл пенициллин / стрептомицин стимулировали 0,5 нг / мл CD3 / CD28 MAb и подвергали воздействию тестируемых соединений. Через 24 ч супернатанты собирали и хранили при -80 ° C до анализа с использованием набора человеческих цитокинов MACSplex 12 (Miltenyi Biotec GmbH, Бергиш-Гладбах, Германия) в соответствии с протоколом производителя для количественной оценки секреции цитокинов.Супернатанты также использовали для фотометрического количественного определения с помощью набора ELISA Ready-Set-Go человека TNF-альфа или IL-1β от eBIoscience (Франкфурт, Германия) в соответствии с инструкциями производителя.

Вмешательство человека в пищу и приготовление образцов сыворотки крови для определения метаболитов AITC меркаптуровой кислоты

Количественное определение метаболитов AITC проводилось в образцах плазмы крови, полученных в ходе интервенционного исследования в Медицинском центре Университета во Фрайбурге, Германия.Образцы были взяты у 4 здоровых молодых людей (3 женщины, 1 мужчина в возрасте от 30 до 40 лет) с нормальным ИМТ и некурящих. Каждый субъект потреблял один раз 10 г коммерчески доступного препарата горчицы (Löwensenf extra, Develey, Мюнхен, Германия), содержащего 24,74 ± 1,76 мкмоль / г свежего веса предварительно сформованного AITC, натощак с необязательным потреблением белого хлеба. Этому вмешательству предшествовала 48-часовая фаза вымывания, состоящая из диеты без глюкозинолатов / ITC. Через 30 минут и, возможно, через 60 минут кровь собирали венепункцией в пробирки с сывороткой и центрифугировали при 2000 g в течение 10 минут, 4 ° C, чтобы получить сыворотку.Затем добавляли TFA и замораживали образцы при -80 ° C. Подготовка образцов сыворотки (300 мкл сыворотки и 100 мкл TFA) проводилась, как описано Kühn et al. (37). Замороженные образцы размораживали, встряхивали (1 мин) и центрифугировали (4 ° C, 10 мин, 20,854 × g). Супернатант переносили в картриджи SPE. Перед переносом картриджи SPE кондиционировали ацетонитрилом (ACN, 3 мл) и уравновешивали водой (3 мл). После нанесения образца картриджи промывали муравьиной кислотой (FA, 3 мл, 0,05 л.1% в воде), а метаболиты элюировали FA (3 мл, 0,1% в ACN: вода, 90:10, об. / Об.). Затем элюаты упаривали досуха в слабом потоке азота. Образцы повторно растворяли в 100 мкл FA (0,1% в ACN: воде, 90:10, об. / Об.). Аликвоты образцов по 5 мкл вводили в систему LC-ESI-MS / MS.

Анализ LC-ESI-MS / MS

Анализ LC-ESI-MS / MS проводили на трехквадрупольном масс-спектрометре API4000 (AB Sciex Germany GmbH, Дармштадт, Германия), оборудованном системой ВЭЖХ Agilent 1200 (Agilent Technologies Deutschland GmbH & Co.KG, Вальдбронн, Германия). Для сбора и обработки данных использовалась программа Analyst 1.6.1 (AB Sciex Germany GmbH, Дармштадт, Германия). Анализ метаболитов меркаптуровой кислоты (AITC-GSH; AITC-CysGly; AITC-Cys; AITC-NAC) проводили согласно Platz et al. (38) с небольшими изменениями. Разделение проводили на колонке Kinetex C18 (Phenomenex, 5 мкм, 100 Å, 150 x 2,1 мм). Автоматический пробоотборник работал при 4 ° C, а заданная температура печи составляла 20 ° C. Постоянный поток 300 мкл / мин использовали для подвижной фазы, которая состояла из 0.1% FA в воде (A) и 0,1% FA в ACN (B). Исходный состав состоял из 80% элюента A, выдерживался в течение 1 мин, затем элюент B увеличивался с 20 до 90% в течение 11 мин и выдерживался в течение 4 мин. Чтобы уравновесить колонку, A увеличивали до 90% и выдерживали в течение 5 мин. Соответствующие параметры МС включают входной потенциал -10 В, температуру десольватационного газа 450 ° C, потенциал распыления ионов -4,5 кВ, газ 1 и газ 2 при 46 фунтах на квадратный дюйм и давление газа завесы 10 фунтов на квадратный дюйм. Анализ проводился в режиме отрицательной ионизации, а количественное определение — с помощью внешней калибровки в диапазоне концентраций от 0.01 мкМ и 100 мкМ каждого метаболита.

Статистика

Данные анализировали с помощью программного обеспечения GraphPad Prism 6.0 (La Jolla, California, USA). Результаты представлены как среднее значение + стандартное отклонение. Статистическую значимость определяли с помощью парного t-критерия или обычного одностороннего дисперсионного анализа с последующим корректирующим тестом Бонферрони. Значения P <0,05 (*) считались статистически значимыми, а <0,01 (**) считались статистически значимыми.

Одобрение исследования

Испытание с участием человека и забор крови для экспериментов in vitro были проведены в соответствии с Хельсинкской декларацией.Интервенционное исследование было одобрено этическим комитетом Университета Фрайбурга этическим голосом 54/20. in vitro Эксперименты на человеческих PBMC были одобрены этическим комитетом Университета Фрайбурга с этическим номером голосования 597/14. Все субъекты предоставили письменное информированное согласие перед забором периферической крови путем венепункции.

Результаты

Функциональная активация рецептора TAS2R38 с помощью AITC

Рецепторы горького вкуса — это метаботропные рецепторы, связанные с G-белком, которые могут передавать сигналы посредством высвобождения внутриклеточного кальция с участием PLCβ-2 (39).Таким образом, способность AITC запускать TAS2R38-зависимую мобилизацию кальция в PBMC человека была впервые исследована с помощью проточной цитометрии. При стимуляции AITC в субпопуляции моноцитов и лимфоцитов был обнаружен устойчивый низкоуровневый приток кальция в зависимости от генотипа, в то время как только носитель не оказывал эффекта (). Статистически значимый поток кальция в моноцитах был очевиден при 0,01 мкМ для PAV / PAV (22%), 10 мкМ для PAV / AVI (18%) и 100 мкМ для генотипов AVI / AVI (20%). В клетках PAV / PAV приток кальция увеличивался между 0.От 01 до 1 мкМ (от 28% до 35%), затем выходило на плато между 1-10 мкМ и далее увеличивалось между 10-100 мкМ (от 45% до 72%). Лимфоциты были менее чувствительны к AITC, но все же можно было увидеть генотип-зависимый эффект на приток кальция. Для AVI / AVI и PAV / AVI это было очевидно при 100 мкМ (24% и 21% соответственно), для PAV / PAV при 1 мкМ AITC (25%).

Мобилизация кальция в PBMC человека с различными гаплотипами TAS2R38 после стимуляции AITC. PBMC выделяли и подвергали воздействию AITC или контроля растворителя (SC, 0.1% ДМСО). Измерение потока кальция на основе проточной цитометрии было обнаружено в моноцитах (A – C) и лимфоцитах (D – E) , исследованных с помощью Fluor-4 AM (F EM: 516 нм ) после обработки соединениями. Базовую флуоресценцию регистрировали за 60 секунд до экспонирования. После экспонирования флуоресценцию измеряли еще в течение 740 с. Кальциевый ответ рассчитывали как отношение максимального пика после стимуляции к базальному уровню с использованием программного обеспечения FlowJo. Точки представляют средние значения ± стандартное отклонение, n ≥ 4 ячеек из AVI / AVI (A , D), PAV / AVI (B , E) и PAV / PAV (C , F). предмета.Типичные изображения стратегии гейтирования для моноцитов или лимфоцитов и ответа потока кальция на AITC или SC от одного субъекта приведены справа. Достоверность различия определяли с использованием парного t-критерия по сравнению с соответствующими SC, * p <0,05, ** p <0,01.

Morley et al. (40) продемонстрировали, что растворитель ДМСО может вызвать значительное высвобождение кальция при 1%, а авторы заявили, что уже при 0,2% наблюдались некоторые эффекты растворителя. Кроме того, ДМСО представляет собой добросовестный агонист TAS2R38-PAV, хотя и с низкой активностью, с половинной максимальной (50%) эффективной концентрацией (ЕС 50 ), показанной в 178 мМ трансфицированных клетках HEK293 (~ 1.3% раствор ДМСО) и пороговая концентрация примерно> 125 мМ (~ 0,9% раствор ДМСО) (41). Чтобы исключить, что наблюдаемые эффекты AITC были вызваны растворителем, поток кальция оценивали после воздействия на клетки только ДМСО. При 0,1% ДМСО, наивысшей концентрации растворителя, использованного в настоящем исследовании, не было обнаружено влияния на высвобождение кальция в моноцитах человека (PAV / PAV); начиная с 1,5% ДМСО, наблюдалось среднее увеличение кальция на 36% по сравнению с необработанными клетками, хотя статистическая значимость не была достигнута из-за значительных колебаний измерений ().Мы также поставили под сомнение, может ли приток из внеклеточной среды быть причинно связан с сигналом кальция, обнаруженным после лечения AITC. Помимо рецептора TAS2R38, также сообщалось, что в качестве мишени для AITC используются мембранные каналы ваниллоида 1 и анкирина 1 (TRPV1 и TRPA1) с временным рецепторным потенциалом. И TRPV1, и TRPA1 являются проницаемыми для кальция неселективными катионными каналами. Они функционируют для деполяризации плазматической мембраны и притока кальция (42). Было показано, что AITC активирует TRPA1 посредством ковалентной модификации цистеиновых фрагментов в цитоплазматическом N-конце канала (43), тогда как об активации TRPV1 сообщалось через взаимодействие с сайтом связывания капсаицина (44).Значения EC 50 для активации TRPA1 с помощью AITC варьируются в отчетах с использованием сверхэкспрессирующих TRPA1 клеток от всего лишь 0,6 мкМ (45) до 1,47 мкМ (46) и 3–34 мкМ (47). Таким образом, мы затем определили актуальность внеклеточного притока кальция для наблюдений, сделанных с помощью AITC. Содержание внеклеточного кальция снижалось добавлением хелатирующего агента EDTA в концентрации 0,5 мМ перед воздействием AITC (). Наши данные демонстрируют, что обработка ЭДТА не влияла на приток кальция, вызванный 1 мкМ AITC ().Однако при 100 мкМ AITC значительное снижение потока кальция на 67% можно было увидеть после обработки EDTA, что указывает на значимость внеклеточного кальция при такой высокой концентрации AITC. Для дальнейшего изучения этого были проведены анализы притока кальция с использованием капсазепина в качестве TRPV1 и A-967079 в качестве антагониста TRPA1. Затем ингибиторы использовали при их заявленной половине максимальной ингибирующей концентрации (IC 50 ) и в 10 или 100 раз выше. Снижение опосредованного AITC высвобождения кальция капсазепином можно было обнаружить только при предварительной обработке высокой концентрацией 10 мкМ перед стимуляцией 100 мкМ AITC.Высвобождение кальция, индуцированное 1 мкМ AITC, не влияло (). Аналогичные результаты были получены для ингибирования TRPA1. При использовании концентрации 67 нМ IC 50 , о которой сообщалось в анализах кальция (48), не было обнаружено снижения высвобождения кальция при стимуляции 1 мкМ AITC. Только гораздо более высокие концентрации A-967079 блокировали высвобождение кальция. Частичное снижение на 35% наблюдалось после предварительной обработки 10 мкМ ингибитора TRPA1 в клетках, активированных 100 мкМ AITC (). Эти результаты указывают на специфическую активацию TAS2R38 под действием AITC при низких концентрациях.

Специфичность активации рецептора T2R38 под действием AITC. PBMC были выделены из субъектов с генотипом PAV / PAV и подвергнуты воздействию (A) DMSO или (B) , предварительно обработанных с / без 0,5 мМ EDTA в течение 5 минут, (C) антагонист TRPV1 капсазепин (CPZ) в течение 30 минут, (D), , антагонист TRPA1 A-967079, в течение 30 минут и (E), , антагонист PLC-β2, U73122, в течение 30 минут до воздействия AITC. Затем в субпопуляции моноцитов, зондированной с помощью Fluor-4 AM (F EM: 516 нм ), детектировали измерение потока кальция на основе FACS.Базовая флуоресценция регистрировалась в течение 60 секунд. После воздействия соединения флуоресценцию измеряли еще в течение 740 секунд. Кальциевый ответ рассчитывали как отношение максимального пика после стимуляции к базальному уровню с использованием программного обеспечения FlowJo. Точки представляют средние значения ± стандартное отклонение, n ≥ 3. Достоверность различия определяли с использованием парного t-критерия по сравнению с соответствующим контролем растворителя (SC, 0,1% ДМСО), * p <0,05, ** p <0,01 .

Фосфоинозитид-специфическая фосфолипаза C является ключевым ферментом в регуляции опосредованного IP 3 высвобождения кальция.Чтобы прояснить роль PI-PLCβ в AITC-опосредованной регуляции кальция, использовали ингибитор PI-PLCβ U73122. Как указано в, предварительная обработка клеток U73122 может почти полностью блокировать индуцированное AITC высвобождение кальция.

AITC стимулирует выработку NO и проявляет бактерицидную активность TAS2R38 Генотип, зависимый

Оксид азота (NO) является ключевым свойством иммунных клеток и играет важную роль в защите от патогенов. NO синтезируется ферментом NO-синтазой (NOS), cNOS постоянно присутствует в клетке и зависит от кальция, но iNOS не зависит от кальция и экспрессируется только после стимула (49).Таким образом, затем мы оценили потенциал AITC запускать продукцию NO в ответ на низкоуровневые внутриклеточные изменения кальция, которые, как известно, стимулируют кальмодулин-зависимую активацию NOS (49), с использованием зонда DAF-FM. Наблюдалось незначительное увеличение NO в популяции клеток моноцитов под действием AITC (≥ 10 мкМ) через 1 час в клетках субъектов PAV / PAV, а не AVI / AVI (). После 5-часового воздействия AITC стало очевидным генотип-зависимое производство NO (PAV / PAV: увеличение на 46% при 3 мкМ; AVI / AVI: увеличение на 41% при 100 мкМ).Напротив, не было дифференциальной регуляции продукции NO в популяции лимфоцитов; Продукция NO могла быть обнаружена только после 5-часового воздействия 100 мкМ AITC.

AITC стимулирует продукцию NO и оказывает бактерицидное действие в зависимости от гаплотипа TAS2R38. PBMC были изолированы от субъектов с генотипом AVI / AVI или PAV / PAV, и (A) подверглись воздействию 0,01% DMSO (SC), AITC, донорского NO SNAP (положительный контроль) или cPTIO-акцептора NO в указанные моменты времени. . Затем 0.Добавляли 5 мкМ диацетата DAF-FM на 30 мин. Сигналы флуоресценции (ex 488 нм, em 530 ± 30 нм) контролировали с помощью FACSCalibur ™. Среднюю интенсивность флуоресценции (MFI) каждого образца рассчитывали с использованием программного обеспечения FlowJo (Ashland, Oregon, USA). Типичная гистограмма одного субъекта PAV / PAV показана вверху, (B) инкубировали с E. coli K-12 при MOI 0,5 и подвергали воздействию 0,01% DMSO (SC) или AITC в течение 120 минут при 37 °. С. Деполяризацию потенциала клеточной мембраны определяли путем окрашивания бактерий 1 мкг / мл DiBAC 4 (3) в течение 10 мин в темноте при комнатной температуре.Приведены характерные диаграммы рассеяния E. coli K-12 и PBMC, обработанных E. coli K-12. Сначала был построен график FSC / SSC и селектировано клеток E. coli K-12. Популяцию копировали на диаграмму рассеяния SSC / DiBAC 4 (3), определяющую процент деполяризованных бактерий. Столбцы представляют собой среднее значение + SD, * p <0,05, ** p <0,01. Достоверность различия вычисляли относительно соответствующего контроля с помощью однофакторного дисперсионного анализа.

РВМС человека затем совместно инкубировали с E.coli K12 при множественности инфекции (MOI) 0,5 и изменения мембранного потенциала количественно определены с помощью окрашивания DiBAC 4 (3) (). Хотя в клетках AVI / AVI, обработанных AITC, не наблюдалось никакого эффекта, в клетках PAV / PAV стала очевидна повышенная бактерицидная активность AITC.

AITC модулирует сигнальный путь MAPK и PI3K / AKT Зависимый от генотипа TAS2R38

Путь митоген-активируемых протеинкиназ (MAPKs) является одним из наиболее широко изученных сигнальных путей, которые необходимы для процессов, которые являются центральными для воспалительных реакций иммунных клеток. , е.грамм. Передача сигналов MAPK участвует в клеточном стрессовом ответе, пролиферации и дифференцировке (50). Путь фосфатидилинозитол-3-киназы (PI3K) / AKT также регулирует клеточный метаболизм, рост или выживание; AKT здесь является первичным медиатором сигнального каскада PI3K. В PBMC быстрая активация (5-минутное воздействие AITC) с последующим дефосфорилированием p-ERK1 / 2 и p-p38 была очевидна в группе PAV / PAV после обработки AITC, в отличие от клеток субъектов AVI / AVI () по сравнению с контрольными клетками. Такой же паттерн активации / инактивации можно было наблюдать для p-Akt после обработки AITC в зависимости от генотипа TAS2R38 ().

AITC опосредует нисходящую передачу сигналов MAPK в зависимости от гаплотипа TAS2R38. (A , B) PBMC обрабатывали тестируемыми соединениями в указанные моменты времени и собирали осадок для анализа экспрессии белка. Приведены репрезентативные иммуноблоты. Денситометрический анализ проводили для количественной оценки иммуноблотов с использованием программного обеспечения Quantity One (Bio-Rad, Мюнхен, Германия) и нормализовали по β-актину, который использовали в качестве контроля нагрузки. На графиках показаны уровни фосфорилированного белка ERK1 / 2, p-38 или Akt относительно контроля, определенные с помощью пиксельной денситометрии.Бары средние + SD; * p <0,05, ** p <0,01 (n ≥ 2). Достоверность различия рассчитывали относительно соответствующего контроля растворителя, определенного с помощью однофакторного дисперсионного анализа (SC, 0,01% ДМСО).

AITC ингибирует секрецию TNF-альфа активированных PBMC в зависимости от генотипа TAS2R38

Аналогичным образом, через 5 мин была очевидна повышенная регуляция фосфорилирования p-ERK, p-p38 и p-Akt. лечение 100 пг / мл LPS и AITC у субъектов с PAV / PAV (). Затем мы рассмотрели вопрос о том, различаются ли иммунные ответы между вариантами генотипа TAS2R38 с точки зрения высвобождения цитокинов.Во-первых, мы исследовали, может ли передача клеточных сигналов, запускаемая простым воздействием AITC, опосредовать высвобождение цитокинов в отсутствие каких-либо дополнительных воспалительных стимулов, таких как LPS. Однако при воздействии AITC не было обнаружено никаких изменений в высвобождении TNF-α (данные не показаны). Через 3 часа LPS активировал PBMC, AITC существенно подавлял секрецию TNF-α (пиковое ингибирование 54% при 3 мкМ), и это зависело от функциональности рецептора TAS2R38 (). Продолжительная инкубация с AITC (24 часа) устраняет эффект, наблюдаемый в группе PAV / PAV при всех протестированных концентрациях, что позволяет предположить участие TAS2R38 в раннем врожденном иммунном ответе.С другой стороны, высвобождение провоспалительного цитокина IL-1β было подавлено в группах как AVI / AVI, так и PAV / PAV с помощью AITC (). Анализ qRT-PCR выявил сильное (50%), но временное ингибирование экспрессии мРНК TNF-alpha в PBMC, стимулированных LPS, у субъектов с PAV / PAV с помощью AITC (). Сходные, но менее сильные эффекты наблюдались в стимулированных CD3 / CD28 mAb клетках, полученных от субъектов с гаплотипом PAV / PAV, при воздействии AITC. Никакого эффекта на TNF-α не наблюдалось в группе AVI / AVI после лечения AITC ().В то время как дифференциальное ингибирование IL-1β наблюдалось в клетках PAV / PAV по сравнению с клетками AVI / AVI, модуляция других провоспалительных (IL-2, IL-6 и IL17-A), а также противовоспалительных (IL-10) ) цитокины не были явно зависимыми от генотипа ().

В PBMC, стимулированных бактериальным LPS, AITC запускает активацию MAPK и ингибирование TNF-α в зависимости от генотипа TAS2R38. PBMC подвергали воздействию AITC или 0,01% ДМСО (SC) вместе с 100 пг / мл LPS. (A) Даны репрезентативные иммуноблоты. Денситометрический анализ проводили для количественной оценки иммуноблотов с использованием программного обеспечения Quantity One (Bio-Rad, Мюнхен, Германия) и нормализовали по β-актину, который использовали в качестве контроля нагрузки. (B , C) Секрецию цитокинов через 3 и 24 часа анализировали с использованием наборов ELISA. (D) Временная кинетика экспрессии мРНК TNF-α. Результаты представляют собой средние значения + стандартное отклонение и даны как кратность контроля растворителя. Результаты рассчитывали относительно соответствующего контроля растворителя (SC, 0,01% ДМСО). Достоверность различия определяли по сравнению с соответствующими SC с помощью однофакторного дисперсионного анализа, * p <0,05, ** p <0,01.

В бактериальных РВМС, стимулированных LPS, AITC запускает активацию MAPK, а также высвобождение TNF-α в зависимости от генотипа TAS2R38.PBMC подвергали воздействию AITC или 0,01% DMSO (SC) вместе с 0,5 нг / мл MAb CD3 / CD28 в течение 24 часов (A , B) . Секрецию цитокинов анализировали с использованием набора человеческих цитокинов MACSplex 12 или наборов для ELISA. Результаты представляют собой средние значения + стандартное отклонение и даны как кратность контроля растворителя. Достоверность различия определяли по сравнению с соответствующими SC, как определяли однофакторным дисперсионным анализом, * p <0,05, ** p <0,01.

Уровни AITC в плазме у добровольцев после приема пищи

Фармакокинетика перорального дозирования AITC пока показана только на крысах (51).Затем пиковый уровень в плазме был достигнут в течение 0,5 часа. Таким образом, мы наконец исследовали уровни AITC в плазме у добровольцев после однократного употребления нормальной порции (10 г) препарата горчицы, содержащего 24,75 ± 1,76 мкмоль / г предварительно сформированного AITC, как определено с помощью анализа GC-MS. Через 0,5 ч потребление привело к уровню в плазме крови 836,7 ± 67,7 нМ, через 1 ч — 1001,0 ± 228,3 нМ метаболита AITC-NAC (). Никакие другие метаболиты AITC (AITC-GSH или AITC-CG) не могут быть обнаружены в настоящее время (данные не показаны).

Таблица 1

Количественная оценка уровней AITC в плазме [нмоль / л] после однократного перорального приема обычного препарата горчицы, как определено с помощью LC-ESI-MS / MS.

:
AVI / PVA

12,9669

Еда и питание тесно связаны со здоровьем; еда может быть причиной, а также лекарством от болезни.Однако документально подтверждено, что люди по-разному реагируют на компоненты растений, и взаимодействие продуктов питания и генов может объяснить, почему одни люди более благосклонно реагируют на пищевые вмешательства, чем другие. Межличностные различия в реакции на лекарства среди пациентов также хорошо известны и представляют серьезную проблему для медицины (52, 53). Здесь можно лучше понять, как диета влияет на здоровье, предоставив научные доказательства дифференциальной реакции на биоактивные фитохимические вещества, зависящие от индивидуальных генетических вариаций.Это могло бы стать решающим шагом к индивидуализации или персонализации продуктов питания для достижения более эффективных стратегий профилактики и лечения заболеваний.

Однонуклеотидный полиморфизм в гене рецептора TAS2R38 имеет решающее влияние на индивидуальную чувствительность к горькому вкусу, и, помимо этого, появляется все больше данных, указывающих на важность рецептора TAS2R38 для врожденной иммунной защиты от микробной атаки (8, 26, 27, 54). Наши данные о природном агонисте рецептора TAS2R38 AITC подтверждают эту гипотезу и дополнительно указывают на дополнительную, хотя и менее сильную, роль в адаптивном иммунном ответе.

Субъединица G-белка связывает активированные TAS2R с активностью фосфолипазы C, трифосфата инозита, и это высвобождает кальций из его внутренних запасов (55). Кальций, в свою очередь, является вторым мессенджером, который влияет на многие процессы передачи сигналов в клетках. Используя ингибитор PLCβ-2 U-73122, мы могли подтвердить, что мобилизация кальция, запускаемая AITC, преимущественно происходила через путь AITC-TAS2R38-Gαβγ-PLC в PBMC. Кроме того, наши результаты показывают, что катионные каналы TRPV1 и TRPA1, которые, как известно, также являются мишенью для AITC (46, 56, 57), не учитывают наблюдения при концентрациях, связанных с диетой, а только при надфизиологических концентрациях.В некоторых случаях наблюдались широкие вариации в TAS2R38-зависимом высвобождении кальция.

Это может относиться к индивидуальным уровням экспрессии TAS2R38, о которых сообщалось ранее (58). Более того, оценки горечи людей-добровольцев для 6-н-пропилтиомочевины (PROP), прототипа синтетического агониста TAS2R38, коррелировали с уровнями мРНК TAS2R38-PAV. Несмотря на то, что эти эксперименты проводились на людях, гетерозиготных по аллелям TAS2R38-taster и non-taster, это предполагает, что функция TAS2R38 напрямую связана с уровнями экспрессии TAS2R38-PAV (58).Наблюдаемое несоответствие между пороговой концентрацией AITC в моноцитах (10 нМ) и опубликованными данными in vitro для гетерологично экспрессированного TAS2R38-PAV (10 мкМ) (18) у нас нет немедленного объяснения. Это частично может быть объяснено различными экспериментальными настройками, такими как разные типы клеток. Также мы оценили кальций-зависимые изменения клеточной флуоресценции после длительного воздействия AITC. Это отличается от гетерологичных экспериментов in vitro , где из-за временного характера сигналов кальция в клетках HEK пиковая флуоресценция достигается в течение нескольких секунд после нанесения вещества, хотя стимул обычно все еще присутствует.Следовательно, довольно длительное накопление стимулированных AITC ионов кальция могло сместить предел обнаружения в сторону более низких концентраций.

MAPK ERK1 / 2 активируется преимущественно митогенными факторами, стимулами дифференцировки и цитокинами, тогда как MAPK p38 реагируют на условия клеточного стресса (59). Таким образом, деятельность MAPK подлежит контролю с отрицательной обратной связью. Дефосфорилирование MAPKs играет здесь ключевую роль в определении величины и продолжительности активации киназы и, следовательно, физиологического результата передачи сигналов.Для ERK1 / 2 кальций / кальмодулин / кальциневрин-зависимая инактивация белков была описана ранее (60). В настоящем исследовании быстрая активация с последующим дефосфорилированием ERK1 / 2 и p38 на их сайтах фосфорилирования Thy / Thr, а также Akt на Ser473 может быть замечена при воздействии AITC, но только в клетках от индивидуумов PAV / PAV, что еще раз подтверждает эту идею. четкой регуляции путей передачи ключевых сигналов, зависящих от активации TAS2R38.

NO — это короткоживущий свободный радикал, известный как высоко цитотоксичная и вездесущая молекула-биосланец.NOS представляет собой кальмодулин-связывающий белок и, таким образом, регулирует путь NO (61). Было обнаружено, что в клетках носовых пазух продуцирование NO стимулируется агонистом TAS2R38 PTC в зависимости от генотипа TAS2R38 (28). Его индуцибельная форма (iNOS) отсутствует в покоящихся иммунных клетках и экспрессируется в ответ на стимулы, например. грамм. микробный ЛПС. Макрофаги здесь считаются прототипическими клетками, экспрессирующими iNOS (62–64). Это согласуется с нашим наблюдением, что продукция NO, опосредованная AITC, в основном наблюдалась в субпопуляции моноцитов PBMC.Затем наблюдали более ранний и более интенсивный ответ клеток PAV / PAV на AITC по сравнению с AVI / AVI. Повышенная продукция NO была также обнаружена в эпителиальных клетках PAV / PAV человека> PAV / AVI> AVI / AVI при притоке кальция, инициированном TAS2R38-чувствительными молекулами кворума или PTC. Эта активация в конечном итоге привела к увеличению бактерицидной активности (26, 28). Таким образом, авторы предположили особую роль индуцированной TAS2R38 продукции NO, которая может способствовать бактерицидному действию генотипов PAV / PAV (26, 28).В наших экспериментах такое усиление бактерицидного действия могло быть подтверждено для иммунных клеток PAV / PAV против бактерий E. coli K12.

Иммунный ответ на патогены включает быструю активацию провоспалительных и противовоспалительных механизмов, которые служат для запуска защиты хозяина от микробной инвазии и параллельного поддержания или восстановления гомеостаза тканей (65). TNF-α, помимо ряда других воспалительных цитокинов, является плейотропным и имеет решающее значение для регуляции клеточных реакций на стресс, метаболизма и даже приема пищи (66–68).Результаты на TNF-дефицитных мышах предполагают, что сам цитокин участвует в регуляции рецепции горького вкуса (69). Лечение денатонием, который активирует несколько TAS2R, вызвало незначительное изменение высвобождения цитокинов эпителиальными клетками придаточных пазух носа (70). Заметное снижение продукции множественных цитокинов, включая TNF-α, было показано в LPS-стимулированных лейкоцитах, подвергшихся воздействию денатония или других агонистов T2R (71).

Концентрации соединения, которые оказались активными in vitro , могут не быть достигнуты в организме человека, например.грамм. из-за пониженной биодоступности. До сих пор не поступало данных об уровнях AITC в плазме крови человека при потреблении пищи или приеме фармацевтических препаратов. Здесь мы теперь могли показать, что однократный прием пищевого продукта, содержащего AITC, приводил к уровню AITC в плазме около одного мкМ. Это указывает на достаточную системную биодоступность после нормального приема пищи для запуска TAS2R38-зависимых иммунных клеточных ответов. Теперь необходимо будет изучить возможность применения результатов in vitro в отношении в клинически значимых условиях в хорошо спланированном рандомизированном контролируемом исследовании.

Заключение

На данный момент большинство доступных научных данных в поддержку точного питания основано на наблюдательных исследованиях. Потребуется гораздо больше исследований, прежде чем персонализированное питание сможет принести ожидаемую пользу. Настоящее исследование теперь может предоставить первое биологическое свидетельство дифференциального иммунного ответа на пищевое соединение AITC в зависимости от генотипической характеристики. Во всем мире растения из заказа Brassicales очень популярны и считаются «здоровыми», несмотря на то, что для многих они горькие на вкус.Помимо пищевых продуктов, они используются в народной медицине (например, «горчичники» от бронхита) и в фармацевтических средствах против бактериальных инфекций и воспалений. Возможно, в будущем можно будет идентифицировать людей на основе их генетически детерминированного индивидуального вкусового восприятия, которые больше извлекают выгоду из пищевого вмешательства, содержащего AITC, или будут более восприимчивы к такому лечению, чем другие. Это может помочь в своевременных альтернативных (терапевтических) вмешательствах у людей, унаследовавших нефункциональные аллели TAS2R38.Однако, пока мы не дойдем до этого момента, очевидно, что необходимы дополнительные исследования. Интересно, что в исследовании Meyerhof et al. (18) AITC, а также структурно родственный фенилэтил ITC активировали рецептор TAS2R38-PAV. Напротив, другой ITC, L-сульфорафан, этого не сделал. Таким образом, похоже, существуют некоторые другие, но неизвестные факторы, определяющие способность к активации, и нельзя обобщать наши результаты для всех соединений этого класса.

Заявление о доступности данных

Исходные материалы, представленные в исследовании, включены в статью / дополнительные материалы.Дальнейшие запросы можно направить соответствующему автору.

Заявление об этике

Исследования с участием людей были рассмотрены и одобрены Комитетом по этике Университета Фрайбурга. Пациенты / участники предоставили письменное информированное согласие на участие в этом исследовании.

Вклад авторов

EL разработал исследование и эксперименты. HT, RS, CH, JS, MK и FH разработали и провели эксперименты. HT, RS и EL подготовили графики и проанализировали данные.FH проанализировал AITC в образцах горчицы. EL, SR и MS предоставили исследовательские материалы и реактивы. EL подготовил первую версию рукописи. EL, HT, RS и MB написали статью. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Плата за обработку статьи была частично профинансирована Немецким исследовательским фондом (DFG) и Университетом Фрайбурга в рамках программы финансирования Open Access Publishing. FH финансируется Ассоциацией Лейбница (Leibniz-Junior Research Group OPTIGLUP; J16 / 2017).

Конфликт интересов

Часть исследования финансировалась за счет гранта Repha gmbh, Лангенхаген, Германия. Repha GmbH не участвовала в разработке исследования, интерпретации результатов или написании рукописи.

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть построены как потенциальный конфликт интересов.

Список литературы

1.
Древновски А. Вкусовые предпочтения и прием пищи.Анну Рев Нутр (1997) 17: 237–53. 10.1146 / annurev.nutr.17.1.237
[PubMed] [CrossRef] [Google Scholar] 2.
Sandell M, Breslin PAS. Вариабельность гена вкусовых рецепторов определяет, ощущаем ли мы вкус токсинов в пище. Curr Biol (2006) 16: R792–4. 10.1016 / j.cub.2006.08.049
[PubMed] [CrossRef] [Google Scholar] 3.
Чандрашекар Дж., Мюллер К.Л., Хун М.А., Адлер Э., Фенг Л., Гуо В. и др. . T2R действуют как рецепторы горького вкуса. Cell (2000) 100: 703–11. 10.1016 / s0092-8674 (00) 80706-0
[PubMed] [CrossRef] [Google Scholar] 4.Адлер Э., Хун М.А., Мюллер К.Л., Чандрашекар Дж., Рыба Н.Д.П., Цукер К.С. Новое семейство вкусовых рецепторов млекопитающих. Cell (2000) 100: 693–702. 10.1016 / S0092-8674 (00) 80705-9
[PubMed] [CrossRef] [Google Scholar] 5.
Matsunami H, Montmayeur JP, Buck LB. Семейство кандидатных вкусовых рецепторов человека и мыши. Nature (2000) 404: 601–4. 10.1038 / 35007072
[PubMed] [CrossRef] [Google Scholar] 6.
Bufe B, Breslin PAS, Kuhn C, Reed DR, Tharp CD, Slack JP и др. . Молекулярные основы индивидуальных различий восприятия горечи фенилтиокарбамида и пропилтиоурацила.Curr Biol (2005) 15: 322–7. 10.1016 / j.cub.2005.01.047
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 7.
Ким УК, Йоргенсон Э., Кун Х., Лепперт М., Риш Н., Дрейна Д. Позиционное клонирование локуса количественных признаков человека, лежащего в основе вкусовой чувствительности к фенилтиокарбамиду. Наука (2003) 299: 1221–5. 10.1126 / science.1080190
[PubMed] [CrossRef] [Google Scholar] 8.
Маурер С., Вабниц Г.Х., Кале Н.А., Стегмайер С., Приор Б., Гизе Т. и др. . Дегустация биопленок Pseudomonas aeruginosa: нейтрофилы человека экспрессируют горький рецептор T2R38 в качестве сенсора молекулы, воспринимающей кворум, N- (3-оксододеканоил) -1-лактона гомосерина.Фронт Иммунол (2015) 6: 369. 10.3389 / fimmu.2015.00369
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9.
Malki A, Fiedler J, Fricke K, Ballweg I, Pfaffl MW, Krautwurst D. Пахучие рецепторы класса I, вкусовые рецепторы TAS1R и TAS2R являются маркерами субпопуляций циркулирующих лейкоцитов. Журнал J Leukoc Biol (2015) 97: 533–45. 10.1189 / jlb.2A0714-331RR
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 10.
Tran HTT, Herz C, Ruf P, Stetter R, Lamy E. Экспрессия рецептора горького вкуса T2R38 человека в покоящихся и активированных лимфоцитах.Фронт Иммунол (2018) 9: 2949. 10.3389 / fimmu.2018.02949
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 11.
Sollai G, Melis M, Pani D, Cosseddu P, Usai I., Crnjar R, et al. . Первая объективная оценка вкусовой чувствительности к 6-н-пропилтиоурацилу (ПРОП), парадигмальному вкусовому стимулу человека. Научный журнал (2017) 7: 40353. 10.1038 / srep40353
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 12.
Вудинг С., Ким УК, Бамшад М.Дж., Ларсен Дж., Джорд Л.Б., Дрейна Д. Естественный отбор и молекулярная эволюция в PTC, гене рецептора горького вкуса.Am J Hum Genet (2004) 74: 637–46. 10.1086 / 383092
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14.
Белл Л., Олоеде О.О., Лигноу С., Вагстафф С., Метвен Л. Восприятие вкуса и аромата глюкозинолатов, изотиоцианатов и родственных соединений. Mol Nutr Food Res (2018) 18: e1700990. 10.1002 / mnfr.201700990
[PubMed] [CrossRef] [Google Scholar] 15.
Древновски А., Гомес-Карнерос С. Горький вкус, фитонутриенты и потребитель: обзор. Am J Clin Nutr (2000) 72: 1424–35. 10.1093 / ajcn / 72.6.1424
[PubMed] [CrossRef] [Google Scholar] 16.Фенвик Г.Р., Хини Р.К., Маллин В.Дж. Глюкозинолаты и продукты их распада в пищевых продуктах и ​​пищевых растениях. Crit Rev Food Sci Nutr (1983) 18: 123–201. 10.1080 / 10408398209527361
[PubMed] [CrossRef] [Google Scholar] 17.
Engel E, Baty C, Le Corre D, Souchon I, Martin N. Ароматизирующие соединения, потенциально участвующие в принятии вареной цветной капусты. J Agric Food Chem (2002) 50: 6459–67. 10.1021 / jf025579u
[PubMed] [CrossRef] [Google Scholar] 18.
Мейерхоф В., Батрам С., Кун С., Брокхофф А., Чудоба Е., Буфе Б. и др.. Молекулярные диапазоны рецепторов горького вкуса TAS2R человека. Chem Senses (2010) 35: 157–70. 10.1093 / chemse / bjp092
[PubMed] [CrossRef] [Google Scholar] 19.
Wu C, Du L, Zou L, Zhao L, Huang L, Wang P. Последние достижения в области биосенсоров на основе вкусовых клеток и рецепторов. Sens Actuators B Chem (2014) 201: 75–85. 10.1016 / j.snb.2014.04.021
[CrossRef] [Google Scholar] 21.
Раджакумар Т., Пугалендхи П., Джаяганеш Р., Анантакришнан Д., Гунасекаран К. Влияние аллилизотиоцианата на передачу сигналов NF-kappaB в 7,12-диметилбенз (а) антрацене и индуцированный N-метил-N-нитрозомочевиной канцерогенез молочной железы.Рак молочной железы (2018) 25: 50–9. 10.1007 / s12282-017-0783-у
[PubMed] [CrossRef] [Google Scholar] 22.
Субеди Л., Венкатесан Р., Ким С.Ю. Нейропротекторная и противовоспалительная активность аллилизотиоцианата через ослабление передачи сигналов JNK / NF-kappaB / TNF-альфа. Международный журнал научных исследований (2017) 18: 1423. 10.3390 / ijms18071423
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23.
Вагнер А.Е., Бош-Саадатманди С., Доза J, Шультейс Г., Римбах Г. Противовоспалительный потенциал аллилизотиоцианата — роль Nrf2, NF- (каппа) B и микроРНК-155.J Cell Mol Med (2012) 16: 836–43. 10.1111 / j.1582-4934.2011.01367.x
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 24.
Конрад А., Кольберг Т., Энгельс И., Франк Ю. Исследование in vitro для оценки антибактериальной активности комбинации ботвы настурции (Tropaeoli majoris herba) и корней хрена (Armoraciae rusticanae radix). Arzneimittelforschung (2006) 56: 842–9. 10.1055 / с-0031-1296796
[PubMed] [CrossRef] [Google Scholar] 25.
Goos KH, Albrecht U, Schneider B. Профиль эффективности и безопасности растительного препарата, содержащего настурцию и корень хрена, при остром синусите, остром бронхите и острой инфекции мочевыводящих путей по сравнению с другими видами лечения в повседневной практике / результаты проспективного когортного исследования .Arzneimittelforschung (2006) 56: 249–57. 10.1055 / с-0031-1296717
[PubMed] [CrossRef] [Google Scholar] 26.
Коэн Н.А. Генетика рецептора горького вкуса T2R38 в врожденном иммунитете верхних дыхательных путей и последствия для хронического риносинусита. Ларингоскоп (2017) 127: 44–51. 10.1002 / лари.26198
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 28.
Ли Р.Дж., Сюн Дж., Кофонов Дж. М., Чен Б., Лысенко А., Цзян П. и др. . Полиморфизм вкусовых рецепторов T2R38 лежит в основе восприимчивости к инфекциям верхних дыхательных путей.Дж. Клин Инвест (2012) 122: 4145–59. 10.1172 / jci64240
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 29.
Адапа Н.Д., Уоркман А.Д., Хаджилиадис Д., Дорган Д.Д., Фрейм Д., Брукс С. и др. . Генотип T2R38 коррелирует с качеством жизни придаточных пазух носа у гомозиготных пациентов с муковисцидозом ΔF508. Международный форум Allergy Rhinol (2016) 6: 356–61. 10.1002 / alr.21675
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 30.
Венделл С., Ван Х, Браун М., Купер М., ДеСенси Р., Вейант Р. и др. . Гены вкуса, связанные с кариесом зубов.Дж. Дент Рес (2010) 89: 1198–202. 10.1177 / 0022034510381502
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31.
Каррай М., Стейнке В., Водичка П., Пардини Б., Ранер Н., Холински-Федер Е. и др. . Связь между полиморфизмом гена TAS2R38 и риском колоректального рака: исследование случай-контроль в двух независимых популяциях кавказского происхождения. PloS One (2011) 6: e20464. 10.1371 / journal.pone.0020464
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32.
Ямаки М., Сайто Х., Исоно К., Гото Т., Сиракава Х., Сёдзи Н. и др.. Генотипический анализ генов рецепторов горького вкуса TAS2R38 и TAS2R46 у японских пациентов с раком желудочно-кишечного тракта. J Nutr Sci Vitaminol (2017) 63: 148–54. 10.3177 / jnsv.63.148
[PubMed] [CrossRef] [Google Scholar] 34.
Leikert JF, Räthel TR, Müller C, Vollmar AM, Dirsch VM. Надежное измерение in vitro оксида азота, высвобождаемого из эндотелиальных клеток, с использованием низких концентраций флуоресцентного зонда 4,5-диаминофлуоресцеина. FEBS Lett (2001) 506: 131–4. 10.1016 / s0014-5793 (01) 02901-5
[PubMed] [CrossRef] [Google Scholar] 35.St Laurent CD, Moon TC, Befus AD. Измерение оксида азота в тучных клетках с помощью флуоресцентного индикатора DAF-FM диацетат. Методы Мол Биол (2015) 1220: 339–45. 10.1007 / 978-1-4939-1568-2_21
[PubMed] [CrossRef] [Google Scholar] 36.
Герц С., Хертрампф А., Циммерманн С., Стеттер Н., Вагнер М., Кляйнханс С. и др. . Изотиоцианат эруцин уничтожает теломеразу в клетках гепатоцеллюлярной карциномы in vitro и в модели ГЦК с ортотопической ксенотрансплантатной опухолью. J Cell Mol Med (2014) 18: 2393–403. 10,1111 / jcmm.12412
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 37.
Кюн С., Купке Ф., Бальдерманн С., Клопш Р., Лами Э., Хорнеманн С. и др. . Разнообразные пути выведения бензилглюкозинолата у людей после употребления настурции (Tropaeolum majus L.) — пилотное исследование. Mol Nutr Food Res (2018) 18: 1800588. 10.1002 / mnfr.201800588
[PubMed] [CrossRef] [Google Scholar] 38.
Платц С., Кюн С., Шисс С., Шрайнер М., Кемпер М., Пивоварова О. и др. . Биодоступность и метаболизм бензилглюкозинолата у людей, употребляющих индийский кресс-салат (Tropaeolum majus L.). Mol Nutr Food Res (2016) 60: 652–60. 10.1002 / mnfr.201500633
[PubMed] [CrossRef] [Google Scholar] 39.
Чжан Ю., Хун М.А., Чандрашекар Дж., Мюллер К.Л., Кук Б., Ву Д. и др. . Кодирование сладкого, горького и умами вкусов: разные рецепторные клетки имеют сходные сигнальные пути. Cell (2003) 112: 293–301. 10.1016 / s0092-8674 (03) 00071-0
[PubMed] [CrossRef] [Google Scholar] 40.
Морли П., Уитфилд Дж. Ф. Индуктор дифференцировки, диметилсульфоксид, временно увеличивает внутриклеточную концентрацию ионов кальция в различных типах клеток.J. Cell Physiol (1993) 156: 219–25. 10.1002 / jcp.1041560202
[PubMed] [CrossRef] [Google Scholar] 41.
Verbeurgt C, Veithen A, Carlot S, Tarabichi M, Dumont JE, Hassid S и др. . Рецептор горького вкуса человека T2R38 широко настроен на наличие бактериальных соединений. PloS One (2017) 12: e0181302. 10.1371 / journal.pone.0181302
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42.
Latorre R, Zaelzer C, Brauchi S. Структурно-функциональная близость временных каналов рецепторного потенциала. Q Rev Biophys (2009) 42: 201–46.10,1017 / с00335835099

[PubMed] [CrossRef] [Google Scholar] 43.
Hinman A, Chuang HH, Bautista DM, Julius D. Активация TRP-канала путем обратимой ковалентной модификации. Proc Natl Acad Sci USA (2006) 103: 19564–8. 10.1073 / pnas.0609598103
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 44.
Джис М., Альпизар Я., Боонен Б., Санчес А., Эвераертс В., Сегал А. и др. . Механизмы временной активации рецепторного потенциала ваниллоида 1 и сенсибилизации аллилизотиоцианатом. Mol Pharmacol (2013) 84: 325–34.10.1124 / моль.113.085548
[PubMed] [CrossRef] [Google Scholar] 45.
Нарукава М., Коидзуми К., Ивасаки Ю., Кубота К., Ватанабе Т. Острый компонент галангала, 1’-ацетоксихавикол ацетат, активирует TRPA1. Biosci Biotechnol Biochem (2010) 74: 1694–6. 10.1271 / bbb.100133
[PubMed] [CrossRef] [Google Scholar] 46.
Коидзуми К., Ивасаки Ю., Нарукава М., Иицука Ю., Фукао Т., Секи Т. и др. . Диаллилсульфиды в чесноке активируют как TRPA1, так и TRPV1. Biochem Biophys Res Commun (2009) 382: 545–8. 10.1016 / j.bbrc.2009.03.066
[PubMed] [CrossRef] [Google Scholar] 47.Bessac BF, Jordt SE. Захватывающие каналы TRP: TRPA1 и TRPV1 в химиочувствительности дыхательных путей и контроле рефлекса. Физиология (2008) 23: 360–70. 10.1152 / Physiol.00026.2008
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 48.
Чен Й, Ян Ц, Ван З. Дж. Активированный протеиназой рецептор 2 сенсибилизирует временный потенциал рецептора ваниллоида 1, временный потенциал рецептора ваниллоида 4 и временный потенциал рецептора анкирин 1 при невропатической боли, вызванной паклитакселом. Неврология (2011) 193: 440–51. 10.1016 / j.нейробиология. 2011.06.085
[PubMed] [CrossRef] [Google Scholar] 50.
Джеффри К.Л., Кэмпс М., Роммель С., Маккей С.Р. Ориентация на фосфатазы с двойной специфичностью: манипулирование передачей сигналов киназы MAP и иммунными ответами. Nat Rev Drug Discov (2007) 6: 391–403. 10.1038 / nrd2289
[PubMed] [CrossRef] [Google Scholar] 51.
Ким Й.Дж., Ли Д.Х., Ан Дж., Чунг В.Дж., Чан Й.Дж., Сеонг К.С. и др. . Фармакокинетика, тканевое распределение и антилипогенные / адипогенные эффекты метаболитов аллил-изотиоцианата. PloS One (2015) 10: e0132151.10.1371 / journal.pone.0132151
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 52.
Дорманн Х., Нойберт А., Криги-Рик М., Эггер Т., Радеспиль-Трогер М., Азаз-Лившиц Т. и др. . Повторные госпитализации и нежелательные лекарственные реакции во внутренней медицине: экономические последствия. J Intern Med (2004) 255: 653–63. 10.1111 / j.1365-2796.2004.01326.x
[PubMed] [CrossRef] [Google Scholar] 53.
Будниц Д.С., Поллок Д.А., Вайденбах К.Н., Мендельсон А.Б., Шредер Т.Дж., Аннест Дж.Л. Национальный надзор за посещениями отделений неотложной помощи на предмет амбулаторных побочных эффектов.Джама (2006) 296: 1858–66. 10.1001 / jama.296.15.1858
[PubMed] [CrossRef] [Google Scholar] 54.
Ли Р.Дж., Коэн Н.А. Роль рецептора горького вкуса T2R38 при инфекциях верхних дыхательных путей и хроническом риносинусите. Curr Opin Allergy Clin Immunol (2015) 15: 14–20. 10.1097 / ACI.0000000000000120
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 55.
Deshpande DA, Wang WCH, McIlmoyle EL, Robinett KS, Schillinger RM, An SS и др. . Рецепторы горького вкуса на гладких мышцах дыхательных путей бронходилатируют за счет локальной передачи сигналов кальция и обратной обструкции.Нат Мед (2010) 16: 1299–304. 10,1038 / нм 2237
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 56.
Jordt SE, Bautista DM, Chuang HH, McKemy DD, Zygmunt PM, Hogestatt ED, et al. . Горчичное масло и каннабиноиды возбуждают сенсорные нервные волокна через TRP-канал ANKTM1. Nature (2004) 427: 260–5. 10.1038 / природа02282
[PubMed] [CrossRef] [Google Scholar] 57.
Канг К., Пулвер С.Р., Панзано В.К., Чанг Э.С., Гриффит Л.С., Теобальд Д.Л. и др. . Анализ TRPA1 дрозофилы показывает древнее происхождение химической ноцицепции человека.Природа (2010) 464: 597–600. 10.1038 / природа08848
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 58.
Lipchock SV, Mennella JA, Spielman AI, Reed DR. Восприятие горького человека коррелирует с экспрессией РНК-мессенджера рецептора горечи во вкусовых клетках. Am J Clin Nutr (2013) 98: 1136–43. 10.3945 / ajcn.113.066688
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 59.
Оуэнс Д.М., Кейз С.М. Дифференциальная регуляция передачи сигналов киназы MAP с помощью протеинфосфатаз с двойной специфичностью. Онкоген (2007) 26: 3203–13.10.1038 / sj.onc.1210412
[PubMed] [CrossRef] [Google Scholar] 60.
Agell N, Bachs O, Rocamora N, Villalonga P. Модуляция пути Ras / Raf / MEK / ERK с помощью Ca (2+) и кальмодулина. Cell Signal (2002) 14: 649–54. 10.1016 / s0898-6568 (02) 00007-4
[PubMed] [CrossRef] [Google Scholar] 61.
Дасгупта М., Ханикатт Т, Блюменталь, ДК. Гамма-субъединица киназы фосфорилазы скелетных мышц содержит два несмежных домена, которые действуют согласованно, связывая кальмодулин. J Biol Chem (1989) 264: 17156–63. 10.1016 / S0021-9258 (18) 71472-5
[PubMed] [CrossRef] [Google Scholar] 62.Богдан С., Роллингхофф М., Дифенбах А. Роль оксида азота в врожденном иммунитете. Immunol Rev (2000) 173: 17–26. 10.1034 / j.1600-065x.2000.917307.x
[PubMed] [CrossRef] [Google Scholar] 63.
Reiling N, Kröncke R, Ulmer AJ, Gerdes J, Flad H-D, Hauschildt S. Синтаза оксида азота: экспрессия эндотелиальной Са2 + / кальмодулин-зависимой изоформы в B- и T-лимфоцитах человека. Eur J Immunol (1996) 26: 511–6. 10.1002 / eji.1830260302
[PubMed] [CrossRef] [Google Scholar] 64.
Stuehr DJ, Cho HJ, Kwon NS, Weise MF, Nathan CF.Очистка и характеристика цитокин-индуцированной синтазы окиси азота макрофагов: флавопротеинов, содержащих FAD и FMN. Proc Natl Acad Sci USA (1991) 88: 7773-7. 10.1073 / пнас.88.17.7773
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 65.
Iyer SS, Cheng G. Роль регуляции транскрипции интерлейкина 10 в воспалении и аутоиммунных заболеваниях. Crit Rev Immunol (2012) 32: 23–63. 10.1615 / critrevimmunol.v32.i1.30
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 66.
Кабал-Йерро Л., Лазо П.С.Передача сигнала рецепторами фактора некроза опухоли. Cell Signal (2012) 24: 1297–305. 10.1016 / j.cellsig.2012.02.006
[PubMed] [CrossRef] [Google Scholar] 67.
Силке Дж. Регуляция передачи сигналов TNF: какую запутанную паутину мы плетем. Curr Opin Immunol (2011) 23: 620–6. 10.1016 / j.coi.2011.08.002
[PubMed] [CrossRef] [Google Scholar] 68.
Ваджант Х., Пфизенмайер К., Шойрих П. Передача сигналов фактора некроза опухоли. Cell Death Differ (2003) 10: 45–65. 10.1038 / sj.cdd.4401189
[PubMed] [CrossRef] [Google Scholar] 69.Фэн П., Джётаки М., Ким А., Чай Дж., Саймон Н., Чжоу М. и др. . Регуляция горького вкуса фактором некроза опухоли. Brain Behav Immun (2015) 49: 32–42. 10.1016 / j.bbi.2015.04.001
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 70.
Ли Р.Дж., Кофонов Д.М., Розен П.Л., Зиберт А.П., Чен Б., Дограмджи Л. и др. . Рецепторы горького и сладкого вкуса регулируют врожденный иммунитет верхних дыхательных путей человека. Дж. Клин Инвест (2014) 124: 1393–405. 10.1172 / JCI72094
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 71.Орсмарк-Пьетрас С., Джеймс А., Конрадсен Дж. Р., Нордлунд Б., Сёдерхелл С., Пулккинен В. и др. . Анализ транскриптома показывает активацию рецепторов горького вкуса у тяжелых астматиков. Eur Respir J (2013) 42:65. 10.1183 / 0

36.00077712
[PubMed] [CrossRef] [Google Scholar]

границ | Аллил-изотиоцианат: рецептор-зависимый иммунный модулятор TAS2R38 на стыке между персонализированной медициной и питанием

Введение

В качестве важной составляющей точной медицины точное питание направлено на разработку индивидуальных подходов к питанию для укрепления и поддержания здоровья и предотвращения заболеваний.Стратегии рассматривают дифференцированные реакции на определенные индивидуализированные питательные вещества пищевого происхождения, возникающие из-за взаимодействия между питательными веществами и биологическими процессами. Восприятие вкуса считается важным фактором для изменения пищевого поведения и, как следствие, риска для здоровья и болезней (1). Горечь — один из ключевых атрибутов растений из отряда Brassicales. Считается, что этот вкус опосредован взаимодействием фитохимического класса глюкозинолатов (GLS) и их продуктов разложения мирозиназы изотиоцианатов (ITC) с рецептором горького вкуса TAS2R38, связанным с G-белком, на языке (2).У людей горький вкус воспринимается семейством из 25 различных вкусовых рецепторов (TAS2R), экспрессируемых на клетках вкусовых рецепторов типа II во вкусовых сосочках (3-5). Было обнаружено, что TAS2R38 довольно специфично реагирует на соединения, содержащие тиомочевину [-NH- (C = S) -NH-] или ITC (N = C = S) фрагмент (6, 7). К настоящему времени обнаружено, что рецептор TAS2R38 экспрессируется во многих различных экстрагустационных тканях, но его физиологическое значение в них все еще является предметом многочисленных дискуссий. Экспрессия белка TAS2R38 была недавно обнаружена в периферических иммунных клетках (нейтрофилах, моноцитах и ​​лимфоцитах) (8-10).Что делает рецептор особенно интересным в контексте точной медицины / питания, так это частые однонуклеотидные полиморфизмы (SNP) в гене TAS2R38 человека. Эти SNP вызывают аминокислотные замены, в результате которых образуются два общих гаплотипа: функциональный (пролин-аланин-валин, PAV) и нефункциональный (аланин-валин-изолейцин, AVI) (11). Фактически, почти во всех популяциях людей во всем мире эти два аллеля встречаются с высокой частотой (12), и, как правило, от 25 до 30% населения не являются дегустаторами (13).Синигрин и его продукт GLS-мирозиназа аллил ITC (AITC) являются одними из самых распространенных фитохимических веществ в Brassicaceae (14). Сообщается, что присутствие этих соединений способствует горькому и острому вкусу у овощей Brassica (14, 15), а дегустационные и не дегустирующие гаплотипы TAS2R38 здесь хорошо коррелируют с горькой чувствительностью людей к растениям Brassica (2 ). Например, синигрин был связан с горьким вкусом вареной брюссельской капусты и цветной капусты (16, 17).Было показано, что люди с диплотипом PAV / PAV оценивают интенсивность горечи у овощей Brassicaceae значительно выше, чем у овощей с AVI / AVI (2).

Исследования функциональной экспрессии в клетках HEK293T-Gα16gust44, временно трансфицированных 25 предположительно функциональными ATS2R, показали, что как синигрин, так и AITC избирательно запускали дегустационный вариант рецептора TAS2R38 (18). Wu et al. (19) позже подтвердили свои наблюдения с помощью биосенсора на основе рецептора TAS2R38.AITC известен своим укрепляющим здоровье потенциалом, включая противовоспалительную и иммуномодулирующую способность (20–23). Синигрин / корень хрена, содержащий AITC ( Armoracia rusticana ), используется в фармакологических средствах для лечения воспалительных заболеваний, включая острый синусит, бронхит и инфекции мочевыводящих путей (24, 25). В целом ITC представляют собой известные многоцелевые соединения, взаимодействующие с широким спектром сигнальных путей и молекул (20). Связан ли иммунный ответ, запускаемый AITC, с взаимодействием TAS2R38, до сих пор не исследовано.

Недавние открытия предполагают, что функциональный TAS2R38 имеет отношение к респираторному врожденному иммунитету (26) и предлагается в качестве фактора местной защиты хозяина (27). Дополнительную поддержку этому предоставили Lee et al. (28). В их исследовании было обнаружено, что TAS2R38 играет роль в хроническом риносинусите и обнаружении бактерий. Повышенная предрасположенность к хроническому риносинуситу также связана с нефункциональным (AVI / AVI) диплотипом (28). Нефункциональный диплотип связан у пациентов с муковисцидозом с более тяжелыми симптомами (29), он связан с повышенным риском кариеса (30), повышенным риском колоректального (31) и желудочного (32) рака.

В настоящем исследовании изучали влияние AITC на врожденную и адаптивную иммунную систему человека в зависимости от функционального статуса рецептора TAS2R38. После обработки AITC в субпопуляциях периферической крови человека (PBMC) были обнаружены различные эффекты мобилизации кальция как параметра для активации рецептора, сопряженного с G-белком (GPCR), что дало первые свидетельства функционального взаимодействия рецептора TAS2R38. На основании этих результатов здесь были исследованы дополнительные параметры, со стимулами врожденного и адаптивного иммунного ответа и без них.Селективный бактерицидный потенциал иммунных клеток от функциональных доноров TAS2R38 был продемонстрирован с использованием бактерий E. coli K12 после обработки AITC.

Материалы и методы

Химические вещества

Фетальная телячья сыворотка (FCS), L-глутамин и физиологический раствор с фосфатным буфером (PBS, без Ca и Mg), раствор пенициллин-стрептомицина (P / S), RPMI-1640 и DMEM без фенола красные были от Life Technologies (Дармштадт, Германия). Сбалансированный солевой раствор Хэнка (HBSS) был от PAA Laboratories GmBH (Coelbe, Германия).β-Меркаптоэтанол был приобретен у Fluka (Buchs, Швейцария). Диметилсульфоксид (ДМСО; чистота> 99%) был приобретен у Applichem GmbH (Дармштадт, Германия). Вода, не содержащая нуклеаз, была от Qiagen (Hilden, Германия). LymphoPrep ™ был от Alere Technologies AS (Осло, Норвегия). Иономицин (чистота ≥98%), S -нитрозо- N -ацетил-D (SNAP), карбокси-PTIO (cPTIO), капсазепин и A-967079 были из Cayman Europe (Анн-Арбор, Мичиган, США), U73122 был приобретен у Enzo Life Sciences (Лёррах, Германия).AITC, твин-20, стандартный белок BSA, персульфат аммония и липополисахарид (LPS, из Escherichia coli O11: B4) были получены от Sigma-Aldrich (Тауфкирхен, Германия). Очищенные антитела функционального класса против CD3 и CD28 человека были получены от eBioscience Affymetrix (Франкфурт, Германия). DAF-FM диацетат, флуо-4-AM и Pluronic ™ F-127 были от Thermo Fisher Scientific GmBH (Дармштадт, Германия). DiBAC 4 (3) (Бис- (1,3-дибутилбарбитуровая кислота) триметиноксонол) был получен от Biomol (Гамбург, Германия).ЭДТА (99%, год) приобретали в Serva GmbH (Гейдельберг, Германия). Нитроцеллюлозные мембраны Amersham ™ ECL Select ™ и Hybond ECL были получены от Ge Healthcare Biosciences AB (Упсала, Швеция), реагент Quick Start Bradford 1x Dye Reagent был от BioRad Laboratories GmbH (Мюнхен, Германия) и Page Ruler Plus Prestained Protein Ladder от Thermo Fisher Scientific (Уолтем, Массачусетс, США). Для иммуноблоттинга использовали следующие первичные антитела: анти-p-ERK1 / 2 (Thr202 / Tyr204, 1: 500), анти-ERK1 / 2 (1: 2000, клон L34F12), анти-p-p38 (Thr180 / Tyr182, 1: 2000), анти-p-Akt (1: 2000, Ser 473, клон D9E), анти-Akt (1: 1000) от Cell Signaling (Дэнверс, Массачусетс, США) и анти-бета-актин (1: 10000, клон AC-74) от Sigma-Aldrich Chemie GmbH (Тауфкирхен, Германия).Вторичные антитела против мыши и кролика, меченные пероксидазой хрена (HRP), были приобретены в Cell Signaling (Danvers, Massachusetts, USA). Муравьиная кислота (FA; 98%) и ацетонитрил (ACN, качество для ультра ЖХ-МС) были приобретены у Carl Roth GmbH Co. KG (Карлсруэ, Германия). Трифторуксусная кислота (TFA, 99,9%) была от Carl Roth GmbH Co. KG (Карлсруэ, Германия) и Applichem GmbH (GmbH (Дармштадт, Германия). Картриджи для твердофазной экстракции C18ec (3 мл, 200 мг) были приобретены у Macherey-Nagel GmbH & Co.KG (Дюрен, Германия). Для всех водных растворов использовалась вода качества Milli-Q.

Выделение PBMC человека

PBMC человека выделяли из свежей периферической крови 30 добровольцев в Университетском медицинском центре во Фрайбурге, Германия. Кровь собирали у добровольцев с использованием Li-гепаринизированных вакутейнеров (Sarstedt, Nümbrecht, Германия). Добровольцы (мужчины и женщины в возрасте от 20 до 35 лет) имели нормальный ИМТ, были здоровы и не курили. РВМС выделяли из крови в течение 2 ч центрифугированием в градиенте LymphoPrep ™ (плотность: 1.077 г / см 3 ) при 1200 г в течение 13 мин при комнатной температуре, используя пробирки SepMate ™ на 50 мл (Гренобль, Франция), затем дважды промывали PBS и определяли жизнеспособность и концентрацию клеток с использованием теста исключения трипанового синего. PBMC использовали непосредственно для иммуноокрашивания или культивировали в среде RPMI 1640 с добавлением 10% инактивированной нагреванием FCS, 2 мМ L-глутамина, 100 Ед / мл пенициллина / стрептомицина при 37 ° C в увлажненном инкубаторе с 5% CO 2. /95% воздушная атмосфера. Активацию клеток проводили с использованием функциональных антител к CD3 и CD28 или LPS (контроль растворителя: водный).

Определение полиморфизма гена TAS2R38

ДНК выделяли из 1×10 6 PBMC с использованием мини-набора QIAamp DNA Blood Mini (Qiagen, Hilden, Германия) в соответствии с протоколом производителя. Фрагмент гена TAS2R38 размером 831 п.н. амплифицировали с использованием следующих олигонуклеотидов в указанной конечной концентрации: прямой 5’ACCAATGCCTTCGTTTTCTTGGTGA’3 и обратный 5’CAGCTACCAAGCCATCATCA ‘3 (33). ПЦР-реакцию проводили в общем объеме 50 мкл, содержащем 20 нг ДНК, 1 ед. ДНК-полимеразы Taq (Life Technologies, Дармштадт, Германия), 0.Прямой праймер 5 мкМ и обратный праймер 0,5 мкМ, смесь dNTP по 0,2 мМ каждый (Life Technologies, Дармштадт, Германия), 1,5 мМ MgCl и 1x ПЦР-буфер (Life Technologies, Дармштадт, Германия). Условиями ПЦР были: 94 ° C в течение 3 минут с последующими 30 циклами (94 ° C в течение 45 секунд, 54,2 ° C в течение 45 секунд и 72 ° C в течение 90 секунд) и 72 ° C в течение 10 минут. Продукты ПЦР очищали с использованием набора Monarch PCR & DNA Cleanup Kit (New England Biolabs, Франкфурт-на-Майне, Германия) в соответствии с протоколом производителя. Фрагмент ПЦР секвенировали с использованием ПЦР с обратным праймером 5’CAGCTACCAAGCCATCATCA’3 для анализа SNP в положении 145 гена и прямого праймера 5 ‘GGAAGGCACATGAGGACAAT’3 для анализа SNP в положении 785 и положении 886 с помощью GATC (Констанц, Германия) .Последовательности анализировали с помощью программного обеспечения Chromas 2.6.4 (Technelysium, Южный Брисбен, Австралия). Концентрацию ДНК анализировали с помощью NanoDrop (лаборатория Peq, Эрланген, Германия). 5 мкл смеси для ПЦР использовали для визуализации продукта ПЦР в агарозном электрофорезе.

Calcium Flux Assay

Окрашивание PBMC для измерения кальция выполняли, как описано ранее (10). Каждый образец, содержащий 0,5 × 10 6 клеток, анализировали в течение 800 секунд с использованием проточного цитометра FACSCalibur ™ (BD Biosciences, Гейдельберг, Германия).Через 60 секунд клетки подвергали воздействию тестируемых соединений, а затем измеряли еще в течение 740 секунд. Данные анализировали с помощью программного обеспечения FlowJo (Ashland, Oregon, USA).

Обнаружение оксида азота (NO) с помощью проточной цитометрии

PBMC (0,25×10 6 ) суспендировали в среде DMEM и подвергали контролю растворителя, AITC или 100 мкМ NO-донора SNAP (положительный контроль) в 96-луночных планшеты на 30-270 мин в увлажненном инкубаторе (5% CO 2 , 37 ° C). После этого ячейки были загружены 0.5 мкМ диацетата DAF-FM, приготовленного в буфере HBSS, в течение еще 30 мин. Загрузка DAF-FM при такой низкой концентрации позволяет снизить фоновую флуоресценцию и улучшить отношение сигнал / шум в отдельной ячейке (34). После инкубации клетки дважды промывали PBS, затем 30 мин. деэтерификация внутриклеточных диацетатов в темноте при комнатной температуре. Сигналы флуоресценции (ex 488 нм, em 530 ± 30 нм) контролировали с использованием проточного цитометра FACSCalibur ™. Среднюю интенсивность флуоресценции (MFI) каждого образца рассчитывали с использованием программного обеспечения FlowJo (Ashland, Oregon, USA).DAF-FM-DA имеет предел обнаружения около 5 нМ NO (35).

Бактерицидная активность

Бактерии E. coli K-12 выращивали в среде Лурия-Бертани при 37 ° C до средней логарифмической фазы, как определено с помощью OD600. Затем PBMC (1×10 6 / мл) инкубировали с E. coli K-12 при MOI 0,5 в среде RPMI 1640, дополненной 2% инактивированной нагреванием фетальной телячьей сывороткой, и подвергали воздействию тестируемых соединений в течение 120 мин в условия увлажнения (5% CO 2 , 37 ° C). После этого добавляли 1 мкг / мл красителя для мембранного потенциала DiBAC 4 (3) и инкубировали в течение 10 мин при комнатной температуре в темноте.Впоследствии клетки промывали один раз PBS и центрифугировали при 4500 x g в течение 10 мин. Процент деполяризованных бактерий определяли с использованием проточного цитометра FACSCalibur ™ с длиной волны возбуждения 493 нм.

Анализ белков иммуноблоттингом

Представляющие интерес белки анализировали иммуноблоттингом, как описано ранее (36). Денситометрический анализ проводили для количественной оценки иммуноблотов с использованием программного обеспечения Quantity One (Bio-Rad, Мюнхен, Германия) и нормализовали по β-актину.

Количественная оценка высвобождения цитокинов с помощью метода мультиплексных шариков или анализа ELISA

PBMC (1×10 6 / мл), культивированных в среде RPMI 1640 с добавлением 10% инактивированной нагреванием фетальной сыворотки теленка, 2 мМ L-глутамина, 100 Ед / мл пенициллин / стрептомицин стимулировали 0,5 нг / мл CD3 / CD28 MAb и подвергали воздействию тестируемых соединений. Через 24 ч супернатанты собирали и хранили при -80 ° C до анализа с использованием набора человеческих цитокинов MACSplex 12 (Miltenyi Biotec GmbH, Бергиш-Гладбах, Германия) в соответствии с протоколом производителя для количественной оценки секреции цитокинов.Супернатанты также использовали для фотометрического количественного определения с помощью набора ELISA Ready-Set-Go человека TNF-альфа или IL-1β от eBIoscience (Франкфурт, Германия) в соответствии с инструкциями производителя.

Вмешательство человека в пищу и приготовление образцов сыворотки крови для определения метаболитов AITC меркаптуровой кислоты

Количественное определение метаболитов AITC проводилось в образцах плазмы крови, полученных в ходе интервенционного исследования в Медицинском центре Университета во Фрайбурге, Германия.Образцы были взяты у 4 здоровых молодых людей (3 женщины, 1 мужчина в возрасте от 30 до 40 лет) с нормальным ИМТ и некурящих. Каждый субъект потреблял один раз 10 г коммерчески доступного препарата горчицы (Löwensenf extra, Develey, Мюнхен, Германия), содержащего 24,74 ± 1,76 мкмоль / г свежего веса предварительно сформованного AITC, натощак с необязательным потреблением белого хлеба. Этому вмешательству предшествовала 48-часовая фаза вымывания, состоящая из диеты без глюкозинолатов / ITC. Через 30 минут и, возможно, через 60 минут кровь собирали венепункцией в пробирки с сывороткой и центрифугировали при 2000 g в течение 10 минут, 4 ° C, чтобы получить сыворотку.Затем добавляли TFA и замораживали образцы при -80 ° C. Подготовка образцов сыворотки (300 мкл сыворотки и 100 мкл TFA) проводилась, как описано Kühn et al. (37). Замороженные образцы размораживали, встряхивали (1 мин) и центрифугировали (4 ° C, 10 мин, 20,854 × g). Супернатант переносили в картриджи SPE. Перед переносом картриджи SPE кондиционировали ацетонитрилом (ACN, 3 мл) и уравновешивали водой (3 мл). После нанесения образца картриджи промывали муравьиной кислотой (FA, 3 мл, 0,05 л.1% в воде), а метаболиты элюировали FA (3 мл, 0,1% в ACN: вода, 90:10, об. / Об.). Затем элюаты упаривали досуха в слабом потоке азота. Образцы повторно растворяли в 100 мкл FA (0,1% в ACN: воде, 90:10, об. / Об.). Аликвоты образцов по 5 мкл вводили в систему LC-ESI-MS / MS.

Анализ LC-ESI-MS / MS

Анализ LC-ESI-MS / MS проводили на трехквадрупольном масс-спектрометре API4000 (AB Sciex Germany GmbH, Дармштадт, Германия), оборудованном системой ВЭЖХ Agilent 1200 (Agilent Technologies Deutschland GmbH & Co.KG, Вальдбронн, Германия). Для сбора и обработки данных использовалась программа Analyst 1.6.1 (AB Sciex Germany GmbH, Дармштадт, Германия). Анализ метаболитов меркаптуровой кислоты (AITC-GSH; AITC-CysGly; AITC-Cys; AITC-NAC) проводили согласно Platz et al. (38) с небольшими изменениями. Разделение проводили на колонке Kinetex C18 (Phenomenex, 5 мкм, 100 Å, 150 x 2,1 мм). Автоматический пробоотборник работал при 4 ° C, а заданная температура печи составляла 20 ° C. Постоянный поток 300 мкл / мин использовали для подвижной фазы, которая состояла из 0.1% FA в воде (A) и 0,1% FA в ACN (B). Исходный состав состоял из 80% элюента A, выдерживался в течение 1 мин, затем элюент B увеличивался с 20 до 90% в течение 11 мин и выдерживался в течение 4 мин. Чтобы уравновесить колонку, A увеличивали до 90% и выдерживали в течение 5 мин. Соответствующие параметры МС включают входной потенциал -10 В, температуру десольватационного газа 450 ° C, потенциал распыления ионов -4,5 кВ, газ 1 и газ 2 при 46 фунтах на квадратный дюйм и давление газа завесы 10 фунтов на квадратный дюйм. Анализ проводился в режиме отрицательной ионизации, а количественное определение — с помощью внешней калибровки в диапазоне концентраций от 0.01 мкМ и 100 мкМ каждого метаболита.

Статистика

Данные анализировали с помощью программного обеспечения GraphPad Prism 6.0 (La Jolla, California, USA). Результаты представлены как среднее значение + стандартное отклонение. Статистическую значимость определяли с помощью парного t-критерия или обычного одностороннего дисперсионного анализа с последующим корректирующим тестом Бонферрони. Значения P <0,05 (*) считались статистически значимыми, а <0,01 (**) считались статистически значимыми.

Одобрение исследования

Испытание с участием человека и забор крови для экспериментов in vitro были проведены в соответствии с Хельсинкской декларацией.Интервенционное исследование было одобрено этическим комитетом Университета Фрайбурга этическим голосом 54/20. Эксперименты in vitro на человеческих PBMC были одобрены этическим комитетом Университета Фрайбурга с этическим номером голосования 597/14. Все субъекты предоставили письменное информированное согласие перед забором периферической крови путем венепункции.

Результаты

Функциональная активация рецептора TAS2R38 с помощью AITC

Рецепторы горького вкуса — это метаботропные рецепторы, связанные с G-белком, которые могут передавать сигналы посредством высвобождения внутриклеточного кальция с участием PLCβ-2 (39).Таким образом, способность AITC запускать TAS2R38-зависимую мобилизацию кальция в PBMC человека была впервые исследована с помощью проточной цитометрии. При стимуляции AITC в субпопуляции моноцитов и лимфоцитов был обнаружен устойчивый низкоуровневый приток кальция в зависимости от генотипа, в то время как только носитель не оказывал эффекта (рис. 1). Статистически значимый поток кальция в моноцитах был очевиден при 0,01 мкМ для PAV / PAV (22%), 10 мкМ для PAV / AVI (18%) и 100 мкМ для генотипов AVI / AVI (20%). В клетках PAV / PAV приток кальция увеличивался между 0.От 01 до 1 мкМ (от 28% до 35%), затем выходило на плато между 1-10 мкМ и далее увеличивалось между 10-100 мкМ (от 45% до 72%). Лимфоциты были менее чувствительны к AITC, но все же можно было увидеть генотип-зависимый эффект на приток кальция. Для AVI / AVI и PAV / AVI это было очевидно при 100 мкМ (24% и 21% соответственно), для PAV / PAV при 1 мкМ AITC (25%).

Рисунок 1 Мобилизация кальция в человеческих РВМС с различными гаплотипами TAS2R38 после стимуляции AITC. PBMC выделяли и подвергали воздействию AITC или контроля растворителя (SC, 0.1% ДМСО). Измерение потока кальция на основе проточной цитометрии было обнаружено в моноцитах (A – C) и лимфоцитах (D – E) , исследованных с помощью Fluor-4 AM (F EM: 516 нм ) после обработки соединениями. Базовую флуоресценцию регистрировали за 60 секунд до экспонирования. После экспонирования флуоресценцию измеряли еще в течение 740 с. Кальциевый ответ рассчитывали как отношение максимального пика после стимуляции к базальному уровню с использованием программного обеспечения FlowJo. Точки представляют средние значения ± стандартное отклонение, n ≥ 4 ячеек из AVI / AVI (A , D), PAV / AVI (B , E) и PAV / PAV (C , F). предмета.Типичные изображения стратегии гейтирования для моноцитов или лимфоцитов и ответа потока кальция на AITC или SC от одного субъекта приведены справа. Достоверность различия определяли с использованием парного t-критерия по сравнению с соответствующими SC, * p <0,05, ** p <0,01.

Morley et al. (40) продемонстрировали, что растворитель ДМСО может вызвать значительное высвобождение кальция при 1%, а авторы заявили, что уже при 0,2% наблюдались некоторые эффекты растворителя. Кроме того, ДМСО представляет собой добросовестный агонист TAS2R38-PAV, хотя и с низкой активностью, с половинной максимальной (50%) эффективной концентрацией (ЕС 50 ), показанной в 178 мМ трансфицированных клетках HEK293 (~ 1.3% раствор ДМСО) и пороговая концентрация примерно> 125 мМ (~ 0,9% раствор ДМСО) (41). Чтобы исключить, что наблюдаемые эффекты AITC были вызваны растворителем, поток кальция оценивали после воздействия на клетки только ДМСО. При 0,1% ДМСО, наивысшей концентрации растворителя, использованного в настоящем исследовании, не было обнаружено влияния на высвобождение кальция в моноцитах человека (PAV / PAV); Начиная с 1,5% ДМСО, наблюдалось среднее увеличение кальция на 36% по сравнению с необработанными клетками, хотя статистическая значимость не была достигнута из-за значительных колебаний измерений (рис. 2А).Мы также поставили под сомнение, может ли приток из внеклеточной среды быть причинно связан с сигналом кальция, обнаруженным после лечения AITC. Помимо рецептора TAS2R38, также сообщалось, что в качестве мишени для AITC используются мембранные каналы ваниллоида 1 и анкирина 1 (TRPV1 и TRPA1) с временным рецепторным потенциалом. И TRPV1, и TRPA1 являются проницаемыми для кальция неселективными катионными каналами. Они функционируют для деполяризации плазматической мембраны и притока кальция (42). Было показано, что AITC активирует TRPA1 посредством ковалентной модификации цистеиновых фрагментов в цитоплазматическом N-конце канала (43), тогда как об активации TRPV1 сообщалось через взаимодействие с сайтом связывания капсаицина (44).Значения EC 50 для активации TRPA1 с помощью AITC варьируются в отчетах с использованием сверхэкспрессирующих TRPA1 клеток от всего лишь 0,6 мкМ (45) до 1,47 мкМ (46) и 3–34 мкМ (47). Таким образом, мы затем определили актуальность внеклеточного притока кальция для наблюдений, сделанных с помощью AITC. Содержание внеклеточного кальция было снижено добавлением хелатирующего агента EDTA в концентрации 0,5 мМ перед воздействием AITC (рис. 2B). Наши данные демонстрируют, что лечение ЭДТА не влияло на приток кальция, вызванный 1 мкМ AITC (рис. 2В).Однако при 100 мкМ AITC значительное снижение потока кальция на 67% можно было увидеть после обработки EDTA, что указывает на значимость внеклеточного кальция при такой высокой концентрации AITC. Для дальнейшего изучения этого были проведены анализы притока кальция с использованием капсазепина в качестве TRPV1 и A-967079 в качестве антагониста TRPA1. Затем ингибиторы использовали при их заявленной половине максимальной ингибирующей концентрации (IC 50 ) и в 10 или 100 раз выше. Снижение опосредованного AITC высвобождения кальция капсазепином можно было обнаружить только при предварительной обработке высокой концентрацией 10 мкМ перед стимуляцией 100 мкМ AITC.Высвобождение кальция, индуцированное 1 мкМ AITC, не влияло (рис. 2С). Аналогичные результаты были получены для ингибирования TRPA1. При использовании концентрации 67 нМ IC 50 , о которой сообщалось в анализах кальция (48), не было обнаружено снижения высвобождения кальция при стимуляции 1 мкМ AITC. Только гораздо более высокие концентрации A-967079 блокировали высвобождение кальция. Частичное снижение на 35% наблюдалось после предварительной обработки 10 мкМ ингибитора TRPA1 в клетках, активированных 100 мкМ AITC (рис. 2D).Эти результаты указывают на специфическую активацию TAS2R38 под действием AITC при низких концентрациях.

Рисунок 2 Специфичность активации рецептора T2R38 под действием AITC. PBMC были выделены из субъектов с генотипом PAV / PAV и подвергнуты воздействию (A) DMSO или (B) , предварительно обработанных с / без 0,5 мМ EDTA в течение 5 минут, (C) антагонист TRPV1 капсазепин (CPZ) в течение 30 минут, (D), , антагонист TRPA1 A-967079, в течение 30 минут и (E), , антагонист PLC-β2, U73122, в течение 30 минут до воздействия AITC.Затем в субпопуляции моноцитов, зондированной с помощью Fluor-4 AM (F EM: 516 нм ), детектировали измерение потока кальция на основе FACS. Базовая флуоресценция регистрировалась в течение 60 секунд. После воздействия соединения флуоресценцию измеряли еще в течение 740 секунд. Кальциевый ответ рассчитывали как отношение максимального пика после стимуляции к базальному уровню с использованием программного обеспечения FlowJo. Точки представляют средние значения ± стандартное отклонение, n ≥ 3. Достоверность различия определяли с использованием парного t-критерия по сравнению с соответствующим контролем растворителя (SC, 0.1% ДМСО), * p <0,05, ** p <0,01 .

Фосфоинозитид-специфическая фосфолипаза C является ключевым ферментом в регуляции опосредованного IP 3 высвобождения кальция. Чтобы прояснить роль PI-PLCβ в AITC-опосредованной регуляции кальция, использовали ингибитор PI-PLCβ U73122. Как показано на рисунке 2E, предварительная обработка клеток U73122 может почти полностью блокировать индуцированное AITC высвобождение кальция.

AITC стимулирует выработку NO и проявляет бактерицидную активность TAS2R38 Генотип, зависимый

Оксид азота (NO) является ключевым свойством иммунных клеток и играет важную роль в защите от патогенов.NO синтезируется ферментом NO-синтазой (NOS), cNOS постоянно присутствует в клетке и зависит от кальция, но iNOS не зависит от кальция и экспрессируется только после стимула (49). Таким образом, затем мы оценили потенциал AITC запускать продукцию NO в ответ на низкоуровневые внутриклеточные изменения кальция, которые, как известно, стимулируют кальмодулин-зависимую активацию NOS (49), с использованием зонда DAF-FM. Наблюдалось незначительное увеличение NO в популяции клеток моноцитов под действием AITC (≥ 10 мкМ) через 1 час в клетках субъектов PAV / PAV, а не AVI / AVI (рис. 3A).После 5-часового воздействия AITC стало очевидным генотип-зависимое производство NO (PAV / PAV: увеличение на 46% при 3 мкМ; AVI / AVI: увеличение на 41% при 100 мкМ). Напротив, не было дифференциальной регуляции продукции NO в популяции лимфоцитов; Продукция NO могла быть обнаружена только после 5-часового воздействия 100 мкМ AITC.

Рисунок 3 AITC стимулирует продукцию NO и оказывает бактерицидное действие в зависимости от гаплотипа TAS2R38. PBMC были изолированы от субъектов с генотипом AVI / AVI или PAV / PAV и (A) подверглись воздействию 0.01% ДМСО (SC), AITC, NO-донорный SNAP (положительный контроль) или cPTIO, поглотитель NO для указанных временных точек. Затем добавляли 0,5 мкМ диацетата DAF-FM на 30 мин. Сигналы флуоресценции (ex 488 нм, em 530 ± 30 нм) контролировали с помощью FACSCalibur ™. Среднюю интенсивность флуоресценции (MFI) каждого образца рассчитывали с использованием программного обеспечения FlowJo (Ashland, Oregon, USA). Типичная гистограмма одного субъекта PAV / PAV показана вверху, (B) , инкубированный с E. coli K-12 при MOI 0.5 и подвергали воздействию 0,01% ДМСО (SC) или AITC в течение 120 мин при 37 ° C. Деполяризацию потенциала клеточной мембраны определяли путем окрашивания бактерий 1 мкг / мл DiBAC 4 (3) в течение 10 мин в темноте при комнатной температуре. Приведены характерные диаграммы рассеяния E. coli K-12 и PBMC, обработанных E. coli K-12. Сначала был построен график FSC / SSC и селектировано клеток E. coli K-12. Популяцию копировали на диаграмму рассеяния SSC / DiBAC 4 (3), определяющую процент деполяризованных бактерий.Столбцы представляют собой среднее значение + SD, * p <0,05, ** p <0,01. Достоверность различия вычисляли относительно соответствующего контроля с помощью однофакторного дисперсионного анализа.

РВМС человека затем совместно инкубировали с бактериями E. coli K12 при множественности инфицирования (MOI) 0,5 и изменения мембранного потенциала количественно определяли с использованием окрашивания DiBAC 4 (3) (рис. 3В). Хотя в клетках AVI / AVI, обработанных AITC, не наблюдалось никакого эффекта, в клетках PAV / PAV стала очевидна повышенная бактерицидная активность AITC.

AITC модулирует сигнальный путь MAPK и PI3K / AKT Зависимый от генотипа TAS2R38

Путь митоген-активируемых протеинкиназ (MAPKs) является одним из наиболее широко изученных сигнальных путей, которые необходимы для процессов, которые являются центральными для воспалительных реакций иммунных клеток. , е. грамм. Передача сигналов MAPK участвует в клеточном стрессовом ответе, пролиферации и дифференцировке (50). Путь фосфатидилинозитол-3-киназы (PI3K) / AKT также регулирует клеточный метаболизм, рост или выживание; AKT здесь является первичным медиатором сигнального каскада PI3K.В PBMC быстрая активация (5-минутное воздействие AITC) с последующим дефосфорилированием p-ERK1 / 2 и p-p38 была очевидна в группе PAV / PAV после обработки AITC, в отличие от клеток субъектов AVI / AVI (рис. 4) по сравнению с контрольными клетками. Такой же паттерн активации / инактивации можно было наблюдать для p-Akt после обработки AITC в зависимости от генотипа TAS2R38 (фиг. 4).

Рис. 4 AITC обеспечивает передачу сигналов нисходящего потока MAPK в зависимости от гаплотипа TAS2R38. (A , B) PBMC обрабатывали тестируемыми соединениями в указанные моменты времени и собирали осадок для анализа экспрессии белка.Приведены репрезентативные иммуноблоты. Денситометрический анализ проводили для количественной оценки иммуноблотов с использованием программного обеспечения Quantity One (Bio-Rad, Мюнхен, Германия) и нормализовали по β-актину, который использовали в качестве контроля нагрузки. На графиках показаны уровни фосфорилированного белка ERK1 / 2, p-38 или Akt относительно контроля, определенные с помощью пиксельной денситометрии. Бары средние + SD; * p <0,05, ** p <0,01 (n ≥ 2). Достоверность различия рассчитывалась относительно соответствующего контроля растворителя, определенного с помощью однофакторного дисперсионного анализа (SC, 0.01% ДМСО).

AITC ингибирует секрецию TNF-альфа активированных PBMC в зависимости от генотипа TAS2R38

Аналогичным образом, через 5 мин была очевидна повышенная регуляция фосфорилирования p-ERK, p-p38 и p-Akt. лечение 100 пг / мл LPS и AITC у субъектов с PAV / PAV (рис. 5A). Затем мы рассмотрели вопрос о том, различаются ли иммунные ответы между вариантами генотипа TAS2R38 с точки зрения высвобождения цитокинов. Во-первых, мы исследовали, может ли передача клеточных сигналов, запускаемая простым воздействием AITC, опосредовать высвобождение цитокинов в отсутствие каких-либо дополнительных воспалительных стимулов, таких как LPS.Однако при воздействии AITC не было обнаружено никаких изменений в высвобождении TNF-α (данные не показаны). Через 3 часа LPS активировал PBMC, AITC существенно подавлял секрецию TNF-α (пиковое ингибирование 54% при 3 мкМ), и это зависело от функциональности рецептора TAS2R38 (фиг. 5B). Продолжительная инкубация с AITC (24 часа) устраняет эффект, наблюдаемый в группе PAV / PAV при всех протестированных концентрациях, что позволяет предположить участие TAS2R38 в раннем врожденном иммунном ответе. С другой стороны, высвобождение провоспалительного цитокина IL-1β было подавлено в группах как AVI / AVI, так и PAV / PAV с помощью AITC (фиг. 5C).Анализ qRT-PCR выявил сильное (50%), но временное ингибирование экспрессии мРНК TNF-alpha в LPS-стимулированных PBMC от субъектов PAV / PAV с помощью AITC (фиг. 5D). Сходные, но менее сильные эффекты наблюдались в стимулированных CD3 / CD28 mAb клетках, полученных от субъектов с гаплотипом PAV / PAV, при воздействии AITC. Никакого эффекта на TNF-α не наблюдалось в группе AVI / AVI после лечения AITC (рис. 6A). В то время как дифференциальное ингибирование IL-1β наблюдалось в клетках PAV / PAV по сравнению с клетками AVI / AVI, модуляция других провоспалительных (IL-2, IL-6 и IL17-A), а также противовоспалительных (IL-10 ) цитокины явно не зависели от генотипа (рис. 6В).

Фиг. 5 В PBMC, стимулированных бактериальным LPS, AITC запускает активацию MAPK и ингибирование TNF-α в зависимости от генотипа TAS2R38. PBMC подвергали воздействию AITC или 0,01% ДМСО (SC) вместе с 100 пг / мл LPS. (A) Даны репрезентативные иммуноблоты. Денситометрический анализ проводили для количественной оценки иммуноблотов с использованием программного обеспечения Quantity One (Bio-Rad, Мюнхен, Германия) и нормализовали по β-актину, который использовали в качестве контроля нагрузки. (B , C) Секрецию цитокинов через 3 и 24 часа анализировали с использованием наборов ELISA. (D) Временная кинетика экспрессии мРНК TNF-α. Результаты представляют собой средние значения + стандартное отклонение и даны как кратность контроля растворителя. Результаты рассчитывали относительно соответствующего контроля растворителя (SC, 0,01% ДМСО). Достоверность различия определяли по сравнению с соответствующими SC с помощью однофакторного дисперсионного анализа, * p <0,05, ** p <0,01.

Рисунок 6 В PBMC, стимулированных бактериальным LPS, AITC запускает активацию MAPK, а также высвобождение TNF-α в зависимости от генотипа TAS2R38. PBMC подвергались воздействию AITC или 0.01% ДМСО (SC) вместе с 0,5 нг / мл МА CD3 / CD28 в течение 24 часов (A , B) . Секрецию цитокинов анализировали с использованием набора человеческих цитокинов MACSplex 12 или наборов для ELISA. Результаты представляют собой средние значения + стандартное отклонение и даны как кратность контроля растворителя. Достоверность различия определяли по сравнению с соответствующими SC, как определяли однофакторным дисперсионным анализом, * p <0,05, ** p <0,01.

Уровни AITC в плазме у добровольцев после приема пищи

Фармакокинетика перорального дозирования AITC пока показана только на крысах (51).Затем пиковый уровень в плазме был достигнут в течение 0,5 часа. Таким образом, мы наконец исследовали уровни AITC в плазме у добровольцев после однократного употребления нормальной порции (10 г) препарата горчицы, содержащего 24,75 ± 1,76 мкмоль / г предварительно сформированного AITC, как определено с помощью анализа GC-MS. Через 0,5 ч потребление привело к уровню в плазме крови 836,7 ± 67,7 нМ, через 1 ч — 1001,0 ± 228,3 нМ метаболита AITC-NAC (Таблица 1). Никакие другие метаболиты AITC (AITC-GSH или AITC-CG) не могут быть обнаружены в настоящее время (данные не показаны).

Таблица 1 Количественная оценка уровней AITC в плазме [нмоль / л] после однократного перорального приема обычного препарата горчицы, как определено с помощью LC-ESI-MS / MS.

Обсуждение

Пища и питание тесно связаны со здоровьем; еда может быть причиной, а также лекарством от болезни. Однако документально подтверждено, что люди по-разному реагируют на компоненты растений, и взаимодействие продуктов питания и генов может объяснить, почему одни люди более благосклонно реагируют на пищевые вмешательства, чем другие.Межличностные различия в реакции на лекарства среди пациентов также хорошо известны и представляют серьезную проблему для медицины (52, 53). Здесь можно лучше понять, как диета влияет на здоровье, предоставив научные доказательства дифференциальной реакции на биоактивные фитохимические вещества, зависящие от индивидуальных генетических вариаций. Это могло бы стать решающим шагом к индивидуализации или персонализации продуктов питания для достижения более эффективных стратегий профилактики и лечения заболеваний.

Однонуклеотидный полиморфизм в гене рецептора TAS2R38 имеет решающее влияние на индивидуальную чувствительность к горькому вкусу, и, помимо этого, появляется все больше данных, указывающих на важность рецептора TAS2R38 для врожденной иммунной защиты от микробной атаки (8, 26, 27, 54).Наши данные о природном агонисте рецептора TAS2R38 AITC подтверждают эту гипотезу и дополнительно указывают на дополнительную, хотя и менее сильную, роль в адаптивном иммунном ответе.

Субъединица G-белка связывает активированные TAS2R с активностью фосфолипазы C, трифосфата инозита, и это высвобождает кальций из его внутренних запасов (55). Кальций, в свою очередь, является вторым мессенджером, который влияет на многие процессы передачи сигналов в клетках. Используя ингибитор PLCβ-2 U-73122, мы могли подтвердить, что мобилизация кальция, запускаемая AITC, преимущественно происходила через путь AITC-TAS2R38-Gαβγ-PLC в PBMC.Кроме того, наши результаты показывают, что катионные каналы TRPV1 и TRPA1, которые, как известно, также являются мишенью для AITC (46, 56, 57), не учитывают наблюдения при концентрациях, связанных с диетой, а только при надфизиологических концентрациях. В некоторых случаях наблюдались широкие вариации в TAS2R38-зависимом высвобождении кальция.

Это может относиться к индивидуальным уровням экспрессии TAS2R38, о которых сообщалось ранее (58). Более того, оценки горечи людей-добровольцев для 6-н-пропилтиомочевины (PROP), прототипа синтетического агониста TAS2R38, коррелировали с уровнями мРНК TAS2R38-PAV.Несмотря на то, что эти эксперименты проводились на людях, гетерозиготных по аллелям TAS2R38-taster и non-taster, это предполагает, что функция TAS2R38 напрямую связана с уровнями экспрессии TAS2R38-PAV (58). Наблюдаемое несоответствие между пороговой концентрацией AITC в моноцитах (10 нМ) и опубликованными данными in vitro для гетерологично экспрессированного TAS2R38-PAV (10 мкМ) (18) у нас нет немедленного объяснения. Это частично может быть объяснено различными экспериментальными настройками, такими как разные типы клеток.Также мы оценили кальций-зависимые изменения клеточной флуоресценции после длительного воздействия AITC. Это отличается от гетерологичных экспериментов in vitro , где из-за временного характера сигналов кальция в клетках HEK пиковая флуоресценция достигается в течение нескольких секунд после нанесения вещества, хотя стимул обычно все еще присутствует. Следовательно, довольно длительное накопление стимулированных AITC ионов кальция могло сместить предел обнаружения в сторону более низких концентраций.

MAPK ERK1 / 2 активируется преимущественно митогенными факторами, стимулами дифференцировки и цитокинами, тогда как MAPK p38 реагируют на условия клеточного стресса (59). Таким образом, деятельность MAPK подлежит контролю с отрицательной обратной связью. Дефосфорилирование MAPKs играет здесь ключевую роль в определении величины и продолжительности активации киназы и, следовательно, физиологического результата передачи сигналов. Для ERK1 / 2 кальций / кальмодулин / кальциневрин-зависимая инактивация белков была описана ранее (60).В настоящем исследовании быстрая активация с последующим дефосфорилированием ERK1 / 2 и p38 на их сайтах фосфорилирования Thy / Thr, а также Akt на Ser473 может быть замечена при воздействии AITC, но только в клетках от индивидуумов PAV / PAV, что еще раз подтверждает эту идею. четкой регуляции путей передачи ключевых сигналов, зависящих от активации TAS2R38.

NO — это короткоживущий свободный радикал, известный как высоко цитотоксичная и вездесущая молекула-биосланец. NOS представляет собой кальмодулин-связывающий белок и, таким образом, регулирует путь NO (61).Было обнаружено, что в клетках носовых пазух продуцирование NO стимулируется агонистом TAS2R38 PTC в зависимости от генотипа TAS2R38 (28). Его индуцибельная форма (iNOS) отсутствует в покоящихся иммунных клетках и экспрессируется в ответ на стимулы, например. грамм. микробный ЛПС. Макрофаги здесь считаются прототипическими клетками, экспрессирующими iNOS (62–64). Это согласуется с нашим наблюдением, что продукция NO, опосредованная AITC, в основном наблюдалась в субпопуляции моноцитов PBMC. Затем наблюдали более ранний и более интенсивный ответ клеток PAV / PAV на AITC по сравнению с AVI / AVI.Повышенная продукция NO была также обнаружена в эпителиальных клетках PAV / PAV человека> PAV / AVI> AVI / AVI при притоке кальция, инициированном TAS2R38-чувствительными молекулами кворума или PTC. Эта активация в конечном итоге привела к увеличению бактерицидной активности (26, 28). Таким образом, авторы предположили особую роль индуцированной TAS2R38 продукции NO, которая может способствовать бактерицидному действию генотипов PAV / PAV (26, 28). В наших экспериментах такое усиление бактерицидного действия могло быть подтверждено для иммунных клеток PAV / PAV против E.coli K12 бактерии.

Иммунный ответ на патогены включает быструю активацию провоспалительных и противовоспалительных механизмов, которые служат для запуска защиты хозяина от микробной инвазии и параллельного поддержания или восстановления гомеостаза тканей (65). TNF-α, помимо ряда других воспалительных цитокинов, является плейотропным и имеет решающее значение для регуляции клеточных реакций на стресс, метаболизма и даже приема пищи (66–68). Результаты на TNF-дефицитных мышах предполагают, что сам цитокин участвует в регуляции рецепции горького вкуса (69).Лечение денатонием, который активирует несколько TAS2R, вызвало незначительное изменение высвобождения цитокинов эпителиальными клетками придаточных пазух носа (70). Заметное снижение продукции множественных цитокинов, включая TNF-α, было показано в LPS-стимулированных лейкоцитах, подвергшихся воздействию денатония или других агонистов T2R (71).

Концентрации соединения, которые доказали свою активность in vitro , могут не быть достигнуты в организме человека, например. грамм. из-за пониженной биодоступности. До сих пор не поступало данных об уровнях AITC в плазме крови человека при потреблении пищи или приеме фармацевтических препаратов.Здесь мы теперь могли показать, что однократный прием пищевого продукта, содержащего AITC, приводил к уровню AITC в плазме около одного мкМ. Это указывает на достаточную системную биодоступность после нормального приема пищи для запуска TAS2R38-зависимых иммунных клеточных ответов. Теперь необходимо будет изучить вопрос о том, могут ли результаты in vitro быть переведены в клинически значимые условия, в хорошо спланированном рандомизированном контролируемом исследовании.

Заключение

На данный момент большинство доступных научных данных в поддержку точного питания основано на наблюдательных исследованиях.Потребуется гораздо больше исследований, прежде чем персонализированное питание сможет принести ожидаемую пользу. Настоящее исследование теперь может предоставить первое биологическое свидетельство дифференциального иммунного ответа на пищевое соединение AITC в зависимости от генотипической характеристики. Во всем мире растения из заказа Brassicales очень популярны и считаются «здоровыми», несмотря на то, что для многих они горькие на вкус. Помимо пищевых продуктов, они используются в народной медицине (например, «горчичники» от бронхита) и в фармацевтических средствах против бактериальных инфекций и воспалений.Возможно, в будущем можно будет идентифицировать людей на основе их генетически детерминированного индивидуального вкусового восприятия, которые больше извлекают выгоду из пищевого вмешательства, содержащего AITC, или будут более восприимчивы к такому лечению, чем другие. Это может помочь в своевременных альтернативных (терапевтических) вмешательствах у людей, унаследовавших нефункциональные аллели TAS2R38. Однако, пока мы не дойдем до этого момента, очевидно, что необходимы дополнительные исследования. Интересно, что в исследовании Meyerhof et al. (18) AITC, а также структурно родственный фенилэтил ITC активировали рецептор TAS2R38-PAV.Напротив, другой ITC, L-сульфорафан, этого не сделал. Таким образом, похоже, существуют некоторые другие, но неизвестные факторы, определяющие способность к активации, и нельзя обобщать наши результаты для всех соединений этого класса.

Заявление о доступности данных

Исходные материалы, представленные в исследовании, включены в статью / дополнительные материалы. Дальнейшие запросы можно направить соответствующему автору.

Заявление об этике

Исследования с участием людей были рассмотрены и одобрены Комитетом по этике Университета Фрайбурга.Пациенты / участники предоставили письменное информированное согласие на участие в этом исследовании.

Вклад авторов

EL разработал исследование и эксперименты. HT, RS, CH, JS, MK и FH разработали и провели эксперименты. HT, RS и EL подготовили графики и проанализировали данные. FH проанализировал AITC в образцах горчицы. EL, SR и MS предоставили исследовательские материалы и реактивы. EL подготовил первую версию рукописи. EL, HT, RS и MB написали статью. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Плата за обработку статьи была частично профинансирована Немецким исследовательским фондом (DFG) и Университетом Фрайбурга в рамках программы финансирования Open Access Publishing. FH финансируется Ассоциацией Лейбница (Leibniz-Junior Research Group OPTIGLUP; J16 / 2017).

Конфликт интересов

Часть исследования финансировалась за счет гранта Repha gmbh, Лангенхаген, Германия. Repha GmbH не участвовала в разработке исследования, интерпретации результатов или написании рукописи.

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть построены как потенциальный конфликт интересов.

Ссылки

6. Bufe B, Breslin PAS, Kuhn C, Reed DR, Tharp CD, Slack JP, et al. Молекулярные основы индивидуальных различий восприятия горечи фенилтиокарбамида и пропилтиоурацила. Curr Biol (2005) 15: 322–7. doi: 10.1016 / j.cub.2005.01.047

PubMed Аннотация | CrossRef Полный текст | Google Scholar

7.Ким УК, Йоргенсон Э., Кун Х., Лепперт М., Риш Н., Дрейна Д. Позиционное клонирование локуса количественных признаков человека, лежащего в основе вкусовой чувствительности к фенилтиокарбамиду. Science (2003) 299: 1221–5. DOI: 10.1126 / science.1080190

PubMed Аннотация | CrossRef Полный текст | Google Scholar

8. Маурер С., Вабниц Г.Х., Кале Н.А., Стегмайер С., Приор Б., Гизе Т. и др. Дегустация биопленок Pseudomonas aeruginosa: нейтрофилы человека экспрессируют горький рецептор T2R38 в качестве сенсора молекулы, воспринимающей кворум, N- (3-оксододеканоил) -1-лактона гомосерина. Front Immunol (2015) 6: 369. doi: 10.3389 / fimmu.2015.00369

PubMed Аннотация | CrossRef Полный текст | Google Scholar

9. Malki A, Fiedler J, Fricke K, Ballweg I, Pfaffl MW, Krautwurst D. Одорантные рецепторы класса I, вкусовые рецепторы TAS1R и TAS2R являются маркерами субпопуляций циркулирующих лейкоцитов. J Leukoc Biol (2015) 97: 533–45. doi: 10.1189 / jlb.2A0714-331RR

PubMed Аннотация | CrossRef Полный текст | Google Scholar

10.Tran HTT, Herz C, Ruf P, Stetter R, Lamy E. Экспрессия рецептора горького вкуса T2R38 человека в покоящихся и активированных лимфоцитах. Front Immunol (2018) 9: 2949. doi: 10.3389 / fimmu.2018.02949

PubMed Аннотация | CrossRef Полный текст | Google Scholar

11. Sollai G, Melis M, Pani D, Cosseddu P, Usai I., Crnjar R, et al. Первая объективная оценка вкусовой чувствительности к 6-н-пропилтиоурацилу (ПРОП), парадигмальному вкусовому стимулу человека. Sci Rep (2017) 7: 40353.doi: 10.1038 / srep40353

PubMed Аннотация | CrossRef Полный текст | Google Scholar

12. Вудинг С., Ким УК, Бамшад М.Дж., Ларсен Дж., Джорд Л.Б., Дрейна Д. Естественный отбор и молекулярная эволюция в PTC, гене рецептора горького вкуса. Am J Hum Genet (2004) 74: 637–46. doi: 10.1086 / 383092

PubMed Аннотация | CrossRef Полный текст | Google Scholar

14. Белл Л., Олоеде О.О., Лигноу С., Вагстафф С., Метвен Л. Восприятие вкуса и аромата глюкозинолатов, изотиоцианатов и родственных соединений. Mol Nutr Food Res (2018) 18: e1700990. doi: 10.1002 / mnfr.201700990

CrossRef Полный текст | Google Scholar

16. Фенвик Г.Р., Хини Р.К., Маллин В.Дж. Глюкозинолаты и продукты их распада в пищевых продуктах и ​​пищевых растениях. Crit Rev Food Sci Nutr (1983) 18: 123–201. doi: 10.1080 / 10408398209527361

PubMed Аннотация | CrossRef Полный текст | Google Scholar

17. Энгель Э., Бати С., Ле Корре Д., Сушон И., Мартин Н. Ароматизирующие вещества, потенциально участвующие в принятии вареной цветной капусты. J Agric Food Chem (2002) 50: 6459–67. doi: 10.1021 / jf025579u

PubMed Аннотация | CrossRef Полный текст | Google Scholar

18. Мейерхоф В., Батрам С., Кун С., Брокхофф А., Чудоба Е., Буфе Б. и др. Молекулярные диапазоны рецепторов горького вкуса TAS2R человека. Chem Senses (2010) 35: 157–70. doi: 10.1093 / chemse / bjp092

PubMed Аннотация | CrossRef Полный текст | Google Scholar

19. Wu C, Du L, Zou L, Zhao L, Huang L, Wang P. Последние достижения в области биосенсоров на основе вкусовых клеток и рецепторов.Приводы Sens B Chem (2014) 201: 75–85. doi: 10.1016 / j.snb.2014.04.021

CrossRef Полный текст | Google Scholar

21. Rajakumar T, Pugalendhi P, Jayaganesh R., Ananthakrishnan D, Gunasekaran K. Влияние аллилизотиоцианата на передачу сигналов NF-kappaB в 7,12-диметилбенз (a) антрацене и N-метил-N-нитрозомочевине. канцерогенез молочной железы. Рак молочной железы (2018) 25: 50–9. doi: 10.1007 / s12282-017-0783-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

22.Субеди Л., Венкатесан Р., Ким С.Ю. Нейропротекторная и противовоспалительная активность аллилизотиоцианата через ослабление передачи сигналов JNK / NF-kappaB / TNF-альфа. Int J Mol Sci (2017) 18: 1423. doi: 10.3390 / ijms18071423

CrossRef Полный текст | Google Scholar

23. Wagner AE, Boesch-Saadatmandi C, Dose J, Schultheiss G, Rimbach G. Противовоспалительный потенциал аллилизотиоцианата — роль Nrf2, NF- (каппа) B и микроРНК-155. J Cell Mol Med (2012) 16: 836–43.doi: 10.1111 / j.1582-4934.2011.01367.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

24. Конрад А., Кольберг Т., Энгельс И., Франк Ю. Исследование in vitro для оценки антибактериальной активности комбинации ботвы настурции (Tropaeoli majoris herba) и корней хрена (Armoraciae rusticanae radix) . Arzneimittelforschung (2006) 56: 842–9. doi: 10.1055 / s-0031-1296796

PubMed Аннотация | CrossRef Полный текст | Google Scholar

25.Goos KH, Albrecht U, Schneider B. Профиль эффективности и безопасности растительного препарата, содержащего настурцию и корень хрена, при остром синусите, остром бронхите и острой инфекции мочевыводящих путей по сравнению с другими видами лечения в повседневной практике / результаты проспективного когортного исследования . Arzneimittelforschung (2006) 56: 249–57. doi: 10.1055 / s-0031-1296717

PubMed Аннотация | CrossRef Полный текст | Google Scholar

26. Коэн Н.А. Генетика рецептора горького вкуса T2R38 в врожденном иммунитете верхних дыхательных путей и последствия для хронического риносинусита. Ларингоскоп (2017) 127: 44–51. doi: 10.1002 / lary.26198

PubMed Аннотация | CrossRef Полный текст | Google Scholar

28. Ли Р.Дж., Сюн Дж., Кофонов Дж. М., Чен Б., Лысенко А., Цзян П. и др. Полиморфизм вкусовых рецепторов T2R38 лежит в основе восприимчивости к инфекциям верхних дыхательных путей. Дж. Клин Инвест (2012) 122: 4145–59. doi: 10.1172 / jci64240

PubMed Аннотация | CrossRef Полный текст | Google Scholar

29. Адапа Н.Д., Уоркман А.Д., Хаджилиадис Д., Дорган Д.Д., Фрейм Д., Брукс С. и др.Генотип T2R38 коррелирует с качеством жизни придаточных пазух носа у гомозиготных пациентов с муковисцидозом ΔF508. Международный форум Allergy Rhinol (2016) 6: 356–61. doi: 10.1002 / alr.21675

PubMed Аннотация | CrossRef Полный текст | Google Scholar

31. Каррай М., Стейнке В., Водичка П., Пардини Б., Ранер Н., Холински-Федер Е. и др. Связь между полиморфизмом гена TAS2R38 и риском колоректального рака: исследование случай-контроль в двух независимых популяциях кавказского происхождения. PloS One (2011) 6: e20464.doi: 10.1371 / journal.pone.0020464

PubMed Аннотация | CrossRef Полный текст | Google Scholar

32. Ямаки М., Сайто Х., Исоно К., Гото Т., Сиракава Х., Сёдзи Н. и др. Генотипический анализ генов рецепторов горького вкуса TAS2R38 и TAS2R46 у японских пациентов с раком желудочно-кишечного тракта. J Nutr Sci Vitaminol (2017) 63: 148–54. doi: 10.3177 / jnsv.63.148

PubMed Аннотация | CrossRef Полный текст | Google Scholar

34. Leikert JF, Räthel TR, Müller C, Vollmar AM, Dirsch VM.Надежное измерение in vitro оксида азота, высвобождаемого из эндотелиальных клеток, с использованием низких концентраций флуоресцентного зонда 4,5-диаминофлуоресцеина. FEBS Lett (2001) 506: 131–4. DOI: 10.1016 / s0014-5793 (01) 02901-5

PubMed Аннотация | CrossRef Полный текст | Google Scholar

35. St Laurent CD, Moon TC, Befus AD. Измерение оксида азота в тучных клетках с помощью флуоресцентного индикатора DAF-FM диацетат. Методы Mol Biol (2015) 1220: 339–45. doi: 10.1007 / 978-1-4939-1568-2_21

PubMed Аннотация | CrossRef Полный текст | Google Scholar

36.Герц С., Хертрампф А., Циммерманн С., Стеттер Н., Вагнер М., Кляйнханс С. и др. Изотиоцианат эруцин уничтожает теломеразу в клетках гепатоцеллюлярной карциномы in vitro и в модели ГЦК с ортотопической ксенотрансплантатной опухолью. J Cell Mol Med (2014) 18: 2393–403. doi: 10.1111 / jcmm.12412

PubMed Аннотация | CrossRef Полный текст | Google Scholar

37. Кюн С., Купке Ф., Бальдерманн С., Клопш Р., Лами Э., Хорнеманн С. и др. Различные пути выведения бензилглюкозинолата у людей после употребления настурции (Tropaeolum majus L.) —Пилотное исследование. Mol Nutr Food Res (2018) 18: 1800588. doi: 10.1002 / mnfr.201800588

CrossRef Полный текст | Google Scholar

38. Platz S, Kühn C, Schiess S, Schreiner M, Kemper M, Pivovarova O, et al. Биодоступность и метаболизм бензилглюкозинолата у людей, употребляющих индийский кресс-салат (Tropaeolum majus L.). Mol Nutr Food Res (2016) 60: 652–60. doi: 10.1002 / mnfr.201500633

PubMed Аннотация | CrossRef Полный текст | Google Scholar

39.Чжан Ю., Хун М.А., Чандрашекар Дж., Мюллер К.Л., Кук Б., Ву Д. и др. Кодирование сладкого, горького и умами вкусов: разные рецепторные клетки имеют сходные сигнальные пути. Cell (2003) 112: 293–301. doi: 10.1016 / s0092-8674 (03) 00071-0

PubMed Реферат | CrossRef Полный текст | Google Scholar

40. Морли П., Уитфилд Дж. Ф. Индуктор дифференцировки, диметилсульфоксид, временно увеличивает внутриклеточную концентрацию ионов кальция в различных типах клеток. J Cell Physiol (1993) 156: 219-25.doi: 10.1002 / jcp.1041560202

PubMed Аннотация | CrossRef Полный текст | Google Scholar

41. Verbeurgt C, Veithen A, Carlot S, Tarabichi M, Dumont JE, Hassid S, et al. Рецептор горького вкуса человека T2R38 широко настроен на наличие бактериальных соединений. PloS One (2017) 12: e0181302. doi: 10.1371 / journal.pone.0181302

PubMed Аннотация | CrossRef Полный текст | Google Scholar

43. Хинман А., Чуанг Х. Х., Баутиста Д. М., Джулиус Д. Активация канала TRP путем обратимой ковалентной модификации. Proc Natl Acad Sci USA (2006) 103: 19564–8. doi: 10.1073 / pnas.0609598103

PubMed Аннотация | CrossRef Полный текст | Google Scholar

44. Джис М., Альпизар Ю.А., Боонен Б., Санчес А., Эвераертс В., Сегал А. и др. Механизмы временной активации рецепторного потенциала ваниллоида 1 и сенсибилизации аллилизотиоцианатом. Mol Pharmacol (2013) 84: 325–34. doi: 10.1124 / mol.113.085548

PubMed Аннотация | CrossRef Полный текст | Google Scholar

45.Нарукава М., Коидзуми К., Ивасаки Ю., Кубота К., Ватанабе Т. Острый компонент галангала, 1’-ацетоксихавикол ацетат, активирует TRPA1. Biosci Biotechnol Biochem (2010) 74: 1694–6. doi: 10.1271 / bbb.100133

PubMed Аннотация | CrossRef Полный текст | Google Scholar

46. Коидзуми К., Ивасаки Ю., Нарукава М., Иицука Ю., Фукао Т., Секи Т. и др. Диаллилсульфиды в чесноке активируют как TRPA1, так и TRPV1. Biochem Biophys Res Commun (2009) 382: 545–8. DOI: 10.1016 / j.bbrc.2009.03.066

PubMed Аннотация | CrossRef Полный текст | Google Scholar

48. Чен Й, Ян Ц., Ван З. Дж. Активированный протеиназой рецептор 2 сенсибилизирует временный потенциал рецептора ваниллоида 1, временный потенциал рецептора ваниллоида 4 и временный потенциал рецептора анкирин 1 при невропатической боли, вызванной паклитакселом. Неврология (2011) 193: 440–51. DOI: 10.1016 / j.neuroscience.2011.06.085

PubMed Реферат | CrossRef Полный текст | Google Scholar

49.Сюэ Q, Ян Y, Zhang R, Xiong H. Регулирование iNOS на иммунных клетках и его роль в заболеваниях. Int J Mol Sci (2018) 19: 3805. doi: 10.3390 / ijms105

CrossRef Полный текст | Google Scholar

50. Джеффри К.Л., Кэмпс М., Роммель С., Маккей С.Р. Ориентация на фосфатазы с двойной специфичностью: манипулирование передачей сигналов киназы MAP и иммунными ответами. Nat Rev Drug Discov (2007) 6: 391–403. DOI: 10.1038 / nrd2289

PubMed Аннотация | CrossRef Полный текст | Google Scholar

51.Ким Й.Дж., Ли Д.Х., Ан Дж., Чунг В.Дж., Чан Й.Дж., Сеонг К.С. и др. Фармакокинетика, тканевое распределение и антилипогенные / адипогенные эффекты метаболитов аллил-изотиоцианата. PloS One (2015) 10: e0132151. doi: 10.1371 / journal.pone.0132151

PubMed Аннотация | CrossRef Полный текст | Google Scholar

52. Дорманн Х., Нойберт А., Криги-Рик М., Эггер Т., Радеспиль-Трогер М., Азаз-Лившиц Т. и др. Повторные госпитализации и нежелательные лекарственные реакции во внутренней медицине: экономические последствия. J Intern Med (2004) 255: 653–63. doi: 10.1111 / j.1365-2796.2004.01326.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

53. Будниц Д.С., Поллок Д.А., Вайденбах К.Н., Мендельсон А.Б., Шредер Т.Дж., Аннест Дж.Л. Национальный надзор за посещениями отделений неотложной помощи на предмет амбулаторных побочных эффектов. Джама (2006) 296: 1858–66. doi: 10.1001 / jama.296.15.1858

PubMed Аннотация | CrossRef Полный текст | Google Scholar

54. Ли Р.Дж., Коэн Н.А.Роль рецептора горького вкуса T2R38 при инфекциях верхних дыхательных путей и хроническом риносинусите. Curr Opin Allergy Clin Immunol (2015) 15: 14–20. doi: 10.1097 / ACI.0000000000000120

PubMed Аннотация | CrossRef Полный текст | Google Scholar

55. Deshpande DA, Wang WCH, McIlmoyle EL, Robinett KS, Schillinger RM, An SS, et al. Рецепторы горького вкуса на гладких мышцах дыхательных путей бронходилатируют за счет локальной передачи сигналов кальция и обратной обструкции. Нат Мед (2010) 16: 1299–304.DOI: 10.1038 / nm.2237

PubMed Аннотация | CrossRef Полный текст | Google Scholar

56. Jordt SE, Bautista DM, Chuang HH, McKemy DD, Zygmunt PM, Hogestatt ED, et al. Горчичное масло и каннабиноиды возбуждают сенсорные нервные волокна через TRP-канал ANKTM1. Nature (2004) 427: 260–5. doi: 10.1038 / nature02282

PubMed Аннотация | CrossRef Полный текст | Google Scholar

57. Канг К., Пулвер С.Р., Панцано В.К., Чанг Э.С., Гриффит Л.С., Теобальд Д.Л. и др. Анализ TRPA1 дрозофилы показывает древнее происхождение химической ноцицепции человека. Nature (2010) 464: 597–600. doi: 10.1038 / nature08848

PubMed Аннотация | CrossRef Полный текст | Google Scholar

58. Lipchock SV, Mennella JA, Spielman AI, Reed DR. Восприятие горького человека коррелирует с экспрессией РНК-мессенджера рецептора горечи во вкусовых клетках. Am J Clin Nutr (2013) 98: 1136–43. doi: 10.3945 / ajcn.113.066688

PubMed Аннотация | CrossRef Полный текст | Google Scholar

60. Agell N, Bachs O, Rocamora N, Villalonga P.Модуляция пути Ras / Raf / MEK / ERK с помощью Ca (2+) и кальмодулина. Cell Signal (2002) 14: 649–54. DOI: 10.1016 / s0898-6568 (02) 00007-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

61. Dasgupta M, Honeycutt T, Blumenthal DK. Гамма-субъединица киназы фосфорилазы скелетных мышц содержит два несмежных домена, которые действуют согласованно, связывая кальмодулин. J Biol Chem (1989) 264: 17156–63. doi: 10.1016 / S0021-9258 (18) 71472-5

PubMed Аннотация | CrossRef Полный текст | Google Scholar

63.Reiling N, Kröncke R, Ulmer AJ, Gerdes J, Flad H-D, Hauschildt S. Синтаза оксида азота: экспрессия эндотелиальной Са2 + / кальмодулин-зависимой изоформы в B- и T-лимфоцитах человека. Eur J Immunol (1996) 26: 511–6. doi: 10.1002 / eji.1830260302

PubMed Аннотация | CrossRef Полный текст | Google Scholar

64. Stuehr DJ, Cho HJ, Kwon NS, Weise MF, Nathan CF. Очистка и характеристика цитокин-индуцированной синтазы окиси азота макрофагов: флавопротеинов, содержащих FAD и FMN. Proc Natl Acad Sci USA (1991) 88: 7773-7. doi: 10.1073 / pnas.88.17.7773

PubMed Аннотация | CrossRef Полный текст | Google Scholar

65. Айер С.С., Ченг Г. Роль регуляции транскрипции интерлейкина 10 в воспалении и аутоиммунных заболеваниях. Crit Rev Immunol (2012) 32: 23–63. doi: 10.1615 / critrevimmunol.v32.i1.30

PubMed Реферат | CrossRef Полный текст | Google Scholar

69. Фэн П., Джётаки М., Ким А., Чай Дж., Саймон Н., Чжоу М. и др.Регуляция горького вкуса фактором некроза опухоли. Brain Behav Immun (2015) 49: 32–42. doi: 10.1016 / j.bbi.2015.04.001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

70. Ли Р.Дж., Кофонов Д.М., Розен П.Л., Зиберт А.П., Чен Б., Дограмджи Л. и др. Рецепторы горького и сладкого вкуса регулируют врожденный иммунитет верхних дыхательных путей человека. Дж. Клин Инвест (2014) 124: 1393–405. doi: 10.1172 / JCI72094

PubMed Аннотация | CrossRef Полный текст | Google Scholar

71.Орсмарк-Пьетрас С., Джеймс А., Конрадсен Дж. Р., Нордлунд Б., Сёдерхелл С., Пулккинен В. и др. Анализ транскриптома показывает активацию рецепторов горького вкуса у тяжелых астматиков. Eur Respir J (2013) 42:65. doi: 10.1183 / 0

36.00077712

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Может быть, ваша мама была права?

Постоянный кашель так распространен среди малышей по очень веским причинам. Фактически, бронхиальный кашель — один из наиболее распространенных диагностических кодов при посещении педиатрических стационаров.Родители должны знать, что не всякий кашель бывает плохим и что существует множество эффективных домашних средств от постоянного кашля, некоторые из которых я опишу ниже.

Их поведение настраивает малышей на постоянный кашель. Малыши и младенцы старшего возраста, которые ползают, обычно кашляют чаще, чем дети любого другого возраста. Они подвижны, и во время исследования часто чихают и кашляют другие дети своего роста. Когда ребенок играет в комнате, полной других детей того же размера, он или она, вероятно, вдохнет поток дыхательного воздуха, который чихают или кашляют другие дети.

Контакт рук также играет роль, особенно в случае респираторно-синцитиального вируса. Но если малыш вдыхает, находясь лицом к лицу с чихающим ребенком, гораздо более крупный вирусный инокулят попадает в верхние дыхательные пути и трахею. Кроме того, расстояние от верхних дыхательных путей до трахеи и бронхиального дерева у малыша намного меньше, чем у взрослого, поэтому чихание в лицо почти прямое попадание в дыхательные пути бронхов.

Слизь — это «хорошо»

Слизистый кашель у детей — это нормально.Тем не менее, многие родители считают, что ребенок, у которого мокрый слизистый кашель, болен. Если у ребенка нет хрипов или лихорадки, влажный рыхлый кашель не указывает на какие-либо проблемы с функцией легких; на самом деле это естественная защитная реакция. Слизь — это «хорошая штука». Он обладает антибактериальными и противовирусными свойствами, в том числе антиадгезинами, которые ухудшают способность бактерий прилипать к дыхательным путям.

Многие родители тоже считают, что холодный воздух «плохой» и может вызвать заболевание ребенка.Это правда, что сухой / холодный воздух может вызывать у некоторых детей и взрослых некоторую реактивную одышку. Однако для большинства детей правильная одежда и времяпрепровождение на открытом воздухе фактически снижает риск инфекций верхних дыхательных путей. В Швеции дети дошкольного возраста дремлют на улице в спальных мешках. Тренировки на открытом воздухе особенно хороши, потому что они вызывают дренаж носовых пазух и помогают мобилизовать слизь. Благоприятный эффект физических упражнений в холодную погоду наблюдается у детей с муковисцидозом.(Холодный «бодрый» воздух также применяли для борьбы с туберкулезом в санаториях Альп и Адирондак.)

Другое дело — гипотермия. Ощущение холода после сидения в мокрой одежде или длительного переохлаждения без одежды, по всей видимости, ухудшает иммунную защиту легких (вероятно, связано с очищением ресничек или антиадгезиновой активностью). Можно также «простудиться» в теплую погоду. , (например) промокнув во время дождя, а затем сядя в кондиционер.

Домашние средства правовой защиты

Вот несколько домашних средств, которые я рекомендовал детям с постоянным кашлем из-за бронхита:

Плоды шиповника использовались повсюду в Северной Европе и Сибири в качестве средства от кашля, потому что они являются источником витаминов. C. Плоды шиповника богаты биофлавиноидами, которые помогают «разжижать слизь». Плоды шиповника широко доступны в Соединенных Штатах во многих фруктовых чаях без кофеина. Один из самых известных — чаи «Зингер» от компании Celestial Seasonings.У них очень приятный для детей вкус (Wild Berry Zinger на вкус как виноградный кулаид, а Lemon Zinger на вкус как лимонад). В отличие от сока, эти чаи не калорийны, но могут быть подслащены сахаром или (для детей старшего возраста) медом.

Клюквенный сок помогает защищаться от вирусных инфекций, ослабляя способность вирусов прикрепляться к клетке. Этот эффект дополняет содержание витамина С и его хорошо известную защитную роль против инфекций мочевыводящих путей (за счет снижения способности грамотрицательных бактерий цепляться за стенку мочевого пузыря).30 г клюквенного сока можно добавить в чай ​​из шиповника или лимонад или смешать с яблочным соусом и подавать ложкой.

Виноград сорта Конкорд , как полагают, обладает противовирусными свойствами клюквы. 30 грамм виноградного сока Конкорд можно добавить в шиповник или другой напиток.

Сироп бузины широко используется в Скандинавии и Израиле. Вероятно, он обладает теми же свойствами, что и виноград и клюква.

Зеленый чай содержит биофлавиноиды, улучшающие антибактериальные / противовирусные свойства слизистого слоя.Многие люди говорят мне, что их ребенок не любит чай, но будет пить его, если смешать 30 грамм с лимоном.

Лакричный чай продается в специализированных магазинах Ближнего Востока. Солодка также используется в Израиле от кашля.

Мед. Педиатрическая литература недавно сообщила о результатах контролируемого исследования в больнице в Пенсильвании, которое показало, что чайная ложка гречишного меда помогает успокоить кашель. 1 Однако мед можно давать только детям старше года из-за риска прорастания спор ботулизма в желудочно-кишечном тракте детей младшего возраста.

В The Scientist была интересная статья о вкусовых рецепторах и метаболизме. 2 К удивлению многих, в легких есть рецепторы как для сладкого, так и для горького; сладкое вызывает расширение бронхов, а горькое — сужение бронхов.

Туман соленой воды. Во многих европейских странах выход на берег был средством лечения бронхита и астмы. Исследования, проведенные в Австралии с участием пациентов с муковисцидозом, показали, что у людей с астмой, которые занимались серфингом, функция легких была лучше, чем у тех, кто этого не делал.Это привело к открытию, что солевой туман помогает повысить эффективность «чистящего» действия ресничек. Процедуры ингаляции трехпроцентным нормальным физиологическим раствором включаются в схемы лечения многих детей с муковисцидозом.

Не нужно идти на берег: это может быть еще одно домашнее средство. Родители, которые хотят приготовить себе соль, могут насыпать пару столовых ложек кошерной или морской соли на дно ванны и включить кран душа с горячей водой при закрытой двери ванной.Когда вода попадет на соль, начнет образовываться приятный туман. Затем вы можете вставить пробку и начинать наполнять ванну теплой водой.

Грудь трется. Во всем мире существуют различные виды растираний для груди, которые содержат соединения эвкалипта или камфоры, дающие ощущение тепла на коже. Родители сообщают, что трение грудной клетки помогает при постоянном кашле, но исследований, основанных на фактических данных, немного. Наиболее вероятный механизм действия — расслабление и расширение бронхов.Эти соединения могут быть токсичными при проглатывании, и никогда не оставляйте их там, где ребенок может есть или играть с ними. Если ребенок страдает астмой, запах может вызывать астму. Однако для подавляющего большинства детей нанесение небольшого количества средства на грудь перед сном не может быть опасным.

Немцы делают настой из листьев тимьяна . Они кладут 1 чайную ложку тимьяна в чайный шарик и добавляют горячую воду, чтобы заварить чай. Когда достаточно остынет, пьют чай с медом. Еще одно немецкое средство от кашля — сироп сока плюща , , который можно купить в некоторых магазинах здорового питания.

Горчичники: сейчас вышли из употребления

До Второй мировой войны горчичники широко использовались в Соединенных Штатах. Они по-прежнему доступны в специализированных российских магазинах. Рецепты горчичников меняются от семьи к семье. Вот один от пожилого соседа из северной части штата Нью-Йорк:

Смешайте столовую ложку сухой горчицы со столовой ложкой муки, добавьте столько воды, чтобы паста по консистенции напоминала арахисовое масло. Затем распределите смесь (как арахисовое масло) на квадрате ткани размером 4-6 дюймов, вырезанном из старой майки.Положите еще один слой хлопчатобумажной ткани меньшего размера поверх горчичной пасты и попытайтесь загнуть края так, чтобы горчичная паста запечаталась. Поместите тканевый «бутерброд» в середину груди ребенка всего на минуту или две — — до тех пор, пока ребенок остается, становится тепло.

Итальянка, которую я знаю в Бруклине, использует тот же базовый рецепт, но вместо хлопкового трикотажа она использует газеты, чтобы сэндвич с пастой.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

© 2021 КОПИИ БРЕНДОВЫХ ЧАСОВ
Время отбора проб плазмы
30 мин. 60 мин.
Волонтер A (1) генотип:
PAV / AVI
760,5
Волонтер A (2) 827,2
967.6
Волонтер B (2) 904,9
Волонтер C (1) генотип:
PAV / PAV
79865

851,7

793,1 795,8
Доброволец D (1) генотип:
PAV / PAV
838,1 1057,6
Доброволец D (2)