Анти hbs положительный что это значит: Anti-HBs (антитела к HBs-антигену вируса гепатита B)

Содержание

Anti-HBs (антитела к HBs-антигену вируса гепатита B)

Метод определения
Иммуноферментный анализ (ИФА).

Исследуемый материал
Сыворотка крови

Доступен выезд на дом

Онлайн-регистрация

Показатель наличия защитного иммунитета против вируса гепатита В.

Anti-HBs-антитела появляются в фазе выздоровления после острого гепатита В, обычно через 3 — 4 месяца после элиминации HBsAg (так называемая фаза «окна»). Продолжительность фазы окна может варьировать от 1 месяца до 1 года, в зависимости от состояния иммунной системы больного. В этот период «окна» важно обследовать пациента на anti-HBc IgM.



Anti-HBs-антитела особенно важны в обеспечении иммунной защиты против данного вируса, поэтому количественное определение анти-HBs-антител обычно используют в контроле эффективности иммунитета при вакцинации против гепатита В. Со временем, титр антител снижается вплоть до необнаружения. Иногда возможна пожизненная циркуляция anti-HBs-антител. Появление анти-HBs на фоне клинического улучшения у больного гепатитом В и исчезновение HBsAg является хорошим прогностическим признаком и показателем выздоровления.



При хроническом течении гепатита В возможно параллельное определение поверхностного антигена и антител к нему. Обнаружение анти-HBs в острой фазе гепатита В параллельно с HBsAg свидетельствует о неблагоприятном прогнозе заболевания.



Особенности инфекции. Гепатит B (ВГВ, HВV) острое системное вирусное заболевание. Характеризуется поражением печени и различными внепечёночными проявлениями. Протекает остро или хронически, в желтушной (35%) или безжелтушной (65%) формах. Вирус гепатита В является ретровирусом семейства гепаднавирусов — Hepadnaviridae, содержит ДНК, чрезвычайно устойчив во внешней среде (к УФ-лучам, температуре, детергентам). Гепатит В передаётся с кровью и биологическими жидкостями парентеральным, трансплацентарным, половым и бытовым путями. Группу повышенного риска составляют лица, практикующие внутривенную наркоманию, беспорядочные половые связи, а также медицинские работники, пациенты, нуждающиеся в гемодиализе или переливаниях крови, заключённые, члены семей HBs-положительных лиц, новорождённые от HBs-положительных матерей.



Проникая в организм, вирус гепатита попадает в макрофаги крови и разносится по организму. Репликация вируса происходит в лимфатических узлах, костном мозге, фолликулах селезёнки, макрофагах, гепатоцитах. Повреждение печени обусловлено, в основном, за счёт иммунного лизиса; также вирус оказывает прямое цитопатическое действие. Сходство антигенов вируса с антигенами системы гистосовместимости человека обусловливает возникновение аутоиммунных («системных») реакций.



Поверхностные (HBsAg) и сердцевинные (HBcAg) белки вируса являются антигенами, обусловливая выработку anti-HBs и anti-HBс соответственно. Сердцевинный антиген, попадая в кровь, расщепляется на более устойчивые составные части, одна из которых HBe-Ag также несёт антигеные свойства. На неё и вырабатываются anti-HBe антитела. Генетическая изменчивость HВV способствует «ускользанию» вируса из-под иммунного ответа. С этим связаны трудности в лабораторной диагностике (серонегативный гепатит В), а также хронизация заболевания. Появление атипичных участков ДНК в геноме вируса приводит к фульминантному течению гепатита В.



Инкубационный период в среднем составляет 50 дней, но может растягиваться до 6 месяцев. В конце инкубационного периода повышаются уровни печёночных трансаминаз, увеличиваются печень и селезёнка. Возможно повышение концентрации билирубина до 2 — 2,5 нормальных значений, хотя это не приводит к потемнению мочи. Встречаются гриппоподобный, артралгический, диспептический или смешанный варианты клинического течения продромы. Наиболее неблагоприятным является течение продромы по типу сывороточной болезни (зуд, мигрирующие околосуставные высыпания).



Острый период (2 — 12 дней) протекает с интоксикационным синдромом: снижением аппетита, диспепсией, инверсией сна. В трети случаев возникает желтуха: резко повышается уровень билирубина, слизистые оболочки и кожа окрашиваются в различные оттенки жёлтого цвета, появляется зуд. Наиболее тревожным симптомом является снижение протромбинового индекса и альбумина крови, свидетельствующие о печёночно-клеточной недостаточности. Осложнение заболевания печёночной энцефалопатией свидетельствует об острой гепатодистрофии. Бурный гуморальный иммунный ответ зачастую приводит к появлению иммунных комплексов, оседающих на эндотелии сосудов почек, щитовидной железы, половых органов и др. Возникают васкулиты. В программе системных проявлений HBV-инфекции могут возникать аутоиммунный тиреоидит, хронический гастрит, синдром Шегрена, идеопатическая тромбоцитопеническая пурпура, узелковый периартериит, гломерулонефрит, синдром Гийена Барре, ревматоидный артрит и др.



Фаза выздоровления характеризуется исчезновением признаков холестаза, нормализацией процессов обмена веществ, восстановлением функции печени, на первый план выходят системные проявления заболевания. По сравнению с другими вирусными гепатитами, гепатит В имеет более системный характер, менее благоприятно протекает у детей. Хроническое течение возникает в 5% случаев. «Здоровые носители» HBsAg, также как и больные хроническим гепатитом В, подвержены высокому риску развития цирроза печени и гепато-целлюлярной карциномы. Системные проявления не всегда исчезают вместе с излечением гепатита В.



Разработанные на сегодняшний день вакцины не вызывают вакцино-обусловленного гепатита В, т. к. представляют собой генно-инженерный HBs-антиген. Однако вакцинопрофилактика обеспечивает защиту от гепатита В только на 5 — 7 лет. До вакцинации, по итогам вакцинации и по прошествии 5 лет после вакцинации необходимо исследовать уровень anti-HBs-антител.

Анти- HBs (Anti-HBs)

Анти- HBs (Anti-HBs)

Anti-HBs — Количественное определение в крови специфических защитных постинфекционных или поствакцинальных антител против вирусного гепатита В. Вирус обладает сложной структурой. Основным антигеном оболочки является HBsAg – поверхностный антиген вируса. Существуют биохимические и физико-химические особенности HBsAg, которые позволяют разделить его на несколько субтипов. К каждому субтипу вырабатываются свои специфические антитела. Разные подтипы антигена обнаруживаются в разных регионах мира. Анти-HBs-антитела начинают появляться в крови на 4-12-й неделе после заражения, но сразу связываются с HBsAg, поэтому в определяемом количестве их можно обнаружить только после исчезновения HBsAg. Период между исчезновением антигена и появлением антител (период «окна», или «серологический пробел») может составлять от 1 недели до нескольких месяцев. Титры антител растут медленно, достигая максимума через 6-12 месяцев, и сохраняются в большом количестве более 5 лет. У некоторых выздоравливающих антитела обнаруживаются в крови в течение многих лет (иногда пожизненно). Анти-HBs также образуются при попадании антигенного материала вируса при вакцинации против ВГВ и свидетельствуют об эффективном иммунном ответе на вакцину. Но поствакцинальные антитела не так длительно сохраняются в крови, как постинфекционные. Определение Анти-HBs используют для решения вопроса о целесообразности вакцинации. Например, при положительном анализе введение вакцины не требуется, потому что специфический иммунитет и так существует.

Подготовка к исследованию

Специальной подготовки не требуется.
Не курить в течение 30 минут до сдачи крови.

Показания к исследованию

Каждые 3-6 месяцев при контроле за хроническим вирусным гепатитом В и его лечением.

При наличии данных о перенесённом гепатите неизвестной этиологии.

При обследовании пациентов из группы высокого риска заразиться ВГВ.

При решении вопроса о необходимости вакцинации против вирусного гепатита В.

Через несколько месяцев или лет после введения вакцины.

Интерпретация

 Референсные значения – отрицательно

Положительный результат

Фаза выздоровления после перенесённого гепатита В (при этом в анализах HBsAg отсутствует).

Эффективная вакцинация (ревакцинация потребуется не ранее чем через 5 лет).

Инфицирование другим субтипом вируса гепатита В (при одновременном обнаружении anti-HBs и HBsAg).
Отрицательный результат

Отсутствие вирусного гепатита В (при отрицательных результатах других исследований).

Отсутствие поствакцинального иммунитета.

Вирусный гепатит В в инкубационном, остром или хроническом периоде (при положительных результатах анализа на другие антигены и антитела).
Сомнительный результат

Специфические антитела присутствуют в крови в небольшом количестве (вакцинация может быть отложена на год).

Рекомендуется повторение анализа через некоторое время (в зависимости от клинической ситуации и решения врача).

На результаты могут влиять

У пациентов после переливания крови или компонентов плазмы вероятен ложноположительный результат. Присутствие anti-HBs-антител не является абсолютным показателем полного выздоровления от вирусного гепатита В и полноценной защиты от повторного инфицирования. Учитывая наличие разных серологических подтипов гепатита В, существует вероятность присутствия в крови антител к поверхностным антигенам одного типа и фактическое инфицирование организма вирусом гепатита В другого субтипа. У таких пациентов антитела к HBs и HBs-антиген могут выявляться в крови одновременно.

Назначается в комплексе с

HBsAg
anti-HBcore, суммарные антитела
HBeAg

anti-HBe, антитела

HBV, ДНК,ПЦР ( в плазме) качественный

HBV, ДНК, ПЦР ( в плазме) количественный

anti-HDV, антитела

Anti-HCV, антитела, ИФА

Биохимический анализ крови при заболеваниях ЖКТ

Anti-HBs (антитела к HBs-антигену вируса гепатита B)

Исследуемый материал
Сыворотка крови

Метод определения
Иммуноферментный анализ (ИФА).


Показатель наличия защитного иммунитета против вируса гепатита В.


Anti-HBs-антитела появляются в фазе выздоровления после острого гепатита В, обычно через 3 — 4 месяца после элиминации HBsAg (так называемая фаза «окна»). Продолжительность фазы окна может варьировать от 1 месяца до 1 года, в зависимости от состояния иммунной системы больного. В этот период «окна» важно обследовать пациента на anti-HBc IgM.

Anti-HBs-антитела особенно важны в обеспечении иммунной защиты против данного вируса, поэтому количественное определение анти-HBs-антител обычно используют в контроле эффективности иммунитета при вакцинации против гепатита В. Со временем, титр антител снижается вплоть до необнаружения. Иногда возможна пожизненная циркуляция anti-HBs-антител. Появление анти-HBs на фоне клинического улучшения у больного гепатитом В и исчезновение HBsAg является хорошим прогностическим признаком и показателем выздоровления.

При хроническом течении гепатита В возможно параллельное определение поверхностного антигена и антител к нему. Обнаружение анти-HBs в острой фазе гепатита В параллельно с HBsAg свидетельствует о неблагоприятном прогнозе заболевания.

Особенности инфекции. Гепатит B (ВГВ, HВV) острое системное вирусное заболевание. Характеризуется поражением печени и различными внепечёночными проявлениями. Протекает остро или хронически, в желтушной (35%) или безжелтушной (65%) формах. Вирус гепатита В является ретровирусом семейства гепаднавирусов — Hepadnaviridae, содержит ДНК, чрезвычайно устойчив во внешней среде (к УФ-лучам, температуре, детергентам). Гепатит В передаётся с кровью и биологическими жидкостями парентеральным, трансплацентарным, половым и бытовым путями. Группу повышенного риска составляют лица, практикующие внутривенную наркоманию, беспорядочные половые связи, а также медицинские работники, пациенты, нуждающиеся в гемодиализе или переливаниях крови, заключённые, члены семей HBs-положительных лиц, новорождённые от HBs-положительных матерей.

Проникая в организм, вирус гепатита попадает в макрофаги крови и разносится по организму. Репликация вируса происходит в лимфатических узлах, костном мозге, фолликулах селезёнки, макрофагах, гепатоцитах. Повреждение печени обусловлено, в основном, за счёт иммунного лизиса; также вирус оказывает прямое цитопатическое действие. Сходство антигенов вируса с антигенами системы гистосовместимости человека обусловливает возникновение аутоиммунных («системных») реакций.

Поверхностные (HBsAg) и сердцевинные (HBcAg) белки вируса являются антигенами, обусловливая выработку anti-HBs и anti-HBс соответственно. Сердцевинный антиген, попадая в кровь, расщепляется на более устойчивые составные части, одна из которых HBe-Ag также несёт антигеные свойства. На неё и вырабатываются anti-HBe антитела. Генетическая изменчивость HВV способствует «ускользанию» вируса из-под иммунного ответа. С этим связаны трудности в лабораторной диагностике (серонегативный гепатит В), а также хронизация заболевания. Появление атипичных участков ДНК в геноме вируса приводит к фульминантному течению гепатита В.

Инкубационный период в среднем составляет 50 дней, но может растягиваться до 6 месяцев. В конце инкубационного периода повышаются уровни печёночных трансаминаз, увеличиваются печень и селезёнка. Возможно повышение концентрации билирубина до 2 — 2,5 нормальных значений, хотя это не приводит к потемнению мочи. Встречаются гриппоподобный, артралгический, диспептический или смешанный варианты клинического течения продромы. Наиболее неблагоприятным является течение продромы по типу сывороточной болезни (зуд, мигрирующие околосуставные высыпания).

Острый период (2 — 12 дней) протекает с интоксикационным синдромом: снижением аппетита, диспепсией, инверсией сна. В трети случаев возникает желтуха: резко повышается уровень билирубина, слизистые оболочки и кожа окрашиваются в различные оттенки жёлтого цвета, появляется зуд. Наиболее тревожным симптомом является снижение протромбинового индекса и альбумина крови, свидетельствующие о печёночно-клеточной недостаточности. Осложнение заболевания печёночной энцефалопатией свидетельствует об острой гепатодистрофии. Бурный гуморальный иммунный ответ зачастую приводит к появлению иммунных комплексов, оседающих на эндотелии сосудов почек, щитовидной железы, половых органов и др. Возникают васкулиты. В программе системных проявлений HBV-инфекции могут возникать аутоиммунный тиреоидит, хронический гастрит, синдром Шегрена, идеопатическая тромбоцитопеническая пурпура, узелковый периартериит, гломерулонефрит, синдром Гийена Барре, ревматоидный артрит и др.

Фаза выздоровления характеризуется исчезновением признаков холестаза, нормализацией процессов обмена веществ, восстановлением функции печени, на первый план выходят системные проявления заболевания. По сравнению с другими вирусными гепатитами, гепатит В имеет более системный характер, менее благоприятно протекает у детей. Хроническое течение возникает в 5% случаев. «Здоровые носители» HBsAg, также как и больные хроническим гепатитом В, подвержены высокому риску развития цирроза печени и гепато-целлюлярной карциномы. Системные проявления не всегда исчезают вместе с излечением гепатита В.

Разработанные на сегодняшний день вакцины не вызывают вакцино-обусловленного гепатита В, т. к. представляют собой генно-инженерный HBs-антиген. Однако вакцинопрофилактика обеспечивает защиту от гепатита В только на 5 — 7 лет. До вакцинации, по итогам вакцинации и по прошествии 5 лет после вакцинации необходимо исследовать уровень anti-HBs-антител.

HBsAg, качественный тест (HBs-антиген, поверхностный антиген вируса гепатита B, «австралийский» антиген)

Исследуемый материал
Сыворотка крови

Метод определения
Иммуноферментный анализ (ИФА).

Основной маркёр инфицирования вирусом гепатита В

Внимание. При положительных и сомнительных реакциях, срок выдачи результата может быть увеличен до 2-х рабочих дней.

HBsAg — поверхностный антиген вируса гепатита В, основной маркёр острого и хронического гепатита В — представляет собой белковую молекулу (липопротеин), ответственную за адсорбцию вируса на поверхности гепатоцитов (клеток печени). После встраивания вируса в геном печёночных клеток они начинают продуцировать вирусную ДНК и белки, и новые молекулы HBsAg поступают в кровь. 



В большинстве случаев HBsAg обнаруживается уже в инкубационном периоде и при остром течении гепатита выявляется в крови в течение 5 — 6 месяцев. Обнаружение поверхностного антигена вируса гепатита В в крови дольше 6 месяцев после начала болезни свидетельствует о возможной хронизации процесса. Возможно пожизненное носительство HBsAg.

HBsAg способен активизировать клеточные протоонкогены. Через достаточно длительный срок (более 20 лет) возможно развитие гепатокарциномы.

Особенности инфекции. Гепатит B (ВГВ, HВV) острое системное вирусное заболевание. Характеризуется поражением печени и различными внепечёночными проявлениями. Протекает остро или хронически, в желтушной (35%) или безжелтушной (65%) формах. Вирус гепатита В является ретровирусом семейства гепаднавирусов — Hepadnaviridae, содержит ДНК, чрезвычайно устойчив во внешней среде (к УФ-лучам, температуре, детергентам). Гепатит В передаётся с кровью и биологическими жидкостями парентеральным, трансплацентарным, половым и бытовым путями. Группу повышенного риска составляют лица, практикующие внутривенную наркоманию, беспорядочные половые связи, а также медицинские работники, пациенты, нуждающиеся в гемодиализе или переливаниях крови, заключённые, члены семей HBs-положительных лиц, новорождённые от HBs-положительных матерей.

Проникая в организм, вирус гепатита попадает в макрофаги крови и разносится по организму. Репликация вируса происходит в лимфатических узлах, костном мозге, фолликулах селезёнки, макрофагах, гепатоцитах. Повреждение печени обусловлено, в основном, за счёт иммунного лизиса; также вирус оказывает прямое цитопатическое действие. Сходство антигенов вируса с антигенами системы гистосовместимости человека обусловливает возникновение аутоиммунных («системных») реакций.

Поверхностные (HBsAg) и сердцевинные (HBcAg) белки вируса являются антигенами, обусловливая выработку anti-HBs и anti-HBscore соответственно. Сердцевинный антиген, попадая в кровь, расщепляется на более устойчивые составные части, одна из которых HBe-Ag также несёт антигенные свойства. На неё и вырабатываются anti-HBe антитела. Генетическая изменчивость HВV способствует «ускользанию» вируса из-под иммунного ответа. С этим связаны трудности в лабораторной диагностике (серонегативный гепатит В), а также хронизация заболевания. Появление атипичных участков ДНК в геноме вируса приводит к фульминантному течению гепатита В.

Инкубационный период в среднем составляет 50 дней, но может растягиваться до 6 месяцев. В конце инкубационного периода повышаются уровни печёночных трансаминаз, увеличиваются печень и селезёнка. Возможно повышение концентрации билирубина до 2 — 2,5 нормальных значений, хотя это не приводит к потемнению мочи. Встречаются гриппоподобный, артралгический, диспептический или смешанный варианты клинического течения продромы. Наиболее неблагоприятным является течение продромы по типу сывороточной болезни (зуд, мигрирующие околосуставные высыпания).

Острый период (2 — 12 дней) протекает с интоксикационным синдромом: снижением аппетита, диспепсией, инверсией сна. В трети случаев возникает желтуха: резко повышается уровень билирубина, слизистые оболочки и кожа окрашиваются в различные оттенки жёлтого цвета, появляется зуд. Наиболее тревожным симптомом является снижение протромбинового индекса и альбумина крови, свидетельствующие о печёночно-клеточной недостаточности. Осложнение заболевания печёночной энцефалопатией свидетельствует об острой гепатодистрофии. Бурный гуморальный иммунный ответ зачастую приводит к появлению иммунных комплексов, оседающих на эндотелии сосудов почек, щитовидной железы, половых органов и др. Возникают васкулиты. В программе системных проявлений HBV-инфекции могут возникать аутоиммунный тиреоидит, хронический гастрит, синдром Шегрена, идеопатическая тромбоцитопеническая пурпура, узелковый периартериит, гломерулонефрит, синдром Гийена Барре, ревматоидный артрит и др.

Фаза выздоровления характеризуется исчезновением признаков холестаза, нормализацией процессов обмена веществ, восстановлением функции печени, на первый план выходят системные проявления заболевания. По сравнению с другими вирусными гепатитами, гепатит В имеет более системный характер, менее благоприятно протекает у детей. Хроническое течение возникает в 5% случаев. «Здоровые носители» HBsAg, также как и больные хроническим гепатитом В, подвержены высокому риску развития цирроза печени и гепатоцеллюлярной карциномы. Системные проявления не всегда исчезают вместе с излечением гепатита В.

Разработанные на сегодняшний день вакцины не вызывают вакцино-обусловленного гепатита В, т. к. представляют собой генно-инженерный HBs-антиген. Однако вакцинопрофилактика обеспечивает защиту от гепатита В только на 5 — 7 лет. До вакцинации, по итогам вакцинации и по прошествии 5 лет после вакцинации необходимо исследовать уровень anti-HBs-антител.

Уровень anti-HBs (Ед/л) Рекомендуемые сроки


ревакцинации
менее 10 Немедленно
11 — 100 Через 3 — 6 месяцев
101 — 1000 Через 1 год
1001 — 10000 Через 3,5 года
более 10000 Через 7 лет

Оформление заявок для проведения исследований в ООО «ИНВИТРО» осуществляется по паспорту или документу, его заменяющему (миграционная карта, временная регистрация по месту жительства, удостоверение военнослужащего, справка из паспортного стола при утере паспорта, регистрационная карта учёта из гостиницы). Предъявленный документ в обязательном порядке должен содержать информацию о временной или постоянной регистрации на территории РФ и фотографию. При отсутствии паспорта (документа его заменяющего) пациент вправе оформить анонимную заявку для сдачи биоматериала. При анонимном обследовании, заявке и полученному от клиента образцу биоматериала присваивается номер, известный только пациенту, и медперсоналу, оформлявшему заказ.

! Результаты исследований, выполненных анонимно, не могут быть представлены для госпитализации, профессиональных осмотров и не подлежат регистрации в ОРУИБ.

Вирусный гепатит В | Биомедика

Вирусный гепатит В (HBV) – воспалительное заболевание печени, которое вызывается ДНК-содержащим вирусом гепатита В. Ежегодно в мире регистрируется около 58 миллионов больных только острой формой инфекции. Всего же, по оценке экспертов ВОЗ, в разных странах мира общая численность больных гепатитом В и носителей превышает 1млрд. А по данным Центра по изучению клиники и болезней, предающихся, половым путем (Франция), в настоящее время в мире гепатитом В заражено более 2 млрд. человек.

В подавляющем большинстве случаев при условии своевременной диагностики и адекватного лечения больные острым гепатитом B успешно выздоравливают и приобретают пожизненный иммунитет к повторному заражению. Но если же у инфицированного человека снижен иммунитет, острый период болезни проходит незамеченным, то постепенно течение инфекции затягивается и становится хроническим. В этом случае заболевание медленно прогрессирует и может в дальнейшем перейти в цирроз печени (риск 10-20%) и даже рак печени.

Источником инфекции при гепатите В является больной человек или вирусоноситель. Передается вирус с любой био­логической жидкостью организма, но в первую очередь с кровью. Передача вируса происходит через нарушенные кожные и слизистые покровы, при гемотрансфузиях инфицирован­ной кровью, использовании препаратов из зараженной крови и плохо стерилизованного инструментария. Возможна также передача гепатита В новорожденному от инфицированной матери при родах или после. HBV отличается исключительно высокой инфекционностью.

В организме больного вирусом гепатита В обнаруживаются лабораторным методом маркеры – антигены и антитела, определение которых дает разную информацию, в том числе диагностическую и прогностическую. В зависимости от сочетания этих маркеров можно судить об активности и опасности процесса. При активном вирусном процессе естественное течение заболевания, чаще всего, приводит к формированию в печени фиброза с переходом в цирроз или первичный рак печени.

Именно поэтому, при обнаружении вирусного гепатита В рекомендуется провести ряд лабораторных исследований для определения тактики лечения.Все эти анализы на гепатит В могут быть выполнены в лаборатории медицинского центра «Биомедика», но помните – только лечащий врач может правильно интерпретировать полученные результаты .

Маркеры гепатита В

Поверхностный антиген (HBsAg, австралийский антиген) является основным серологическим маркером BГВ. Он может быть обнаружен в крови при остром или хроническом гепатите. Этот антиген, чаще всего, вызывает образование антител к HBsAg, как часть нормальной иммунной реакции на инфекцию.

Положительный анализ крови на HBs антиген означает наличие острой или хронической HBV-инфекции (носительство HBs антигена) и возможность передачи вируса здоровым людям.

Отрицательный тест означает с большой долей вероятности отсутствие вируса гепатита В в крови.

Антитела к поверхностному антигену (анти-HBsAg) представляют собой протекционные антитела, которые вырабатываются в ответ на попадание в организм поверхностного антигена гепатита B.

Положительный тест означает, что человек защищен иммунитетом от попадания вируса гепатита В по одной из двух причин:

  • Успешно была сделана прививка от гепатита B;
  • Организм справился с острой инфекцией и человек не может заразиться гепатитом снова.

Ядерный «е» антиген гепатита B (HBeAg) является белком, который свидетельствует об активной репликации HBV в тканях печени.

Положительный тест означает высокую инфекционность крови и высокий риск передачи вируса другим людям. Так, его обнаружение в крови беременной указывает на высокую опасность инфицирования новорожденного HBV. Этот маркер используется также для контроля эффективности лечения хронического гепатита В. У большинства больных хроническим гепатитом с высокой активностью процесса HBeAg сохраняется на длительный срок (до нескольких лет).

Антитела к HBeAg (анти-HBe) представляют собой белки, которые образуются в организме в ответ на «e» антиген гепатита B.

В случае благоприятного развития вируса гепатита В у больных постепенно происходит замещение в крови HBеAg на антитела к нему (сероконверсия HBеAg – анти-HBе). На ранней стадии сероконверсии оба эти маркёра могут обнаруживаться одновременно.

Исчезновение HBeAg и быстрое нарастание титра анти-HBе у больного практически исключает угрозу хронизации HBV. Отсутствие такой динамики и выявление монотонно низких концентраций анти-НВе, наоборот, может свидетельствовать о развитии хронического HBV с невысокой репликативной активностью (HBeAg-негативный хронический HBV).

Длительное сохранение HBеAg в крови больного и отсутствие анти-HBе может быть показателем угрозы развития хронического гепатита с высокой репликативной активностью HBV (HBеAg-позитивный хронический ГВ). Таким образом, динамический контроль за системой HBeAg – антиНВе позволяет уже в острую стадию гепатита В надежно прогнозировать его исход.

Антитела к сердцевинному антигену (анти-HBcоr) представляет собой антитела, которые вырабатываются в организме в ответ на присутствие в организме части вируса гепатита, называемого «основной антиген» или «сердцевинный антиген». Смысл этого теста часто зависит от результатов двух других тестов: анти-HBs и HBsAg.

IgM антитела к сердцевинному антигену (анти-HBcorM) используется для выявления острой инфекции.

Положительный тест означает инфицированность вирусом гепатита В в течение последних 6-12 месяцев или обострение хронической инфекции.

Описанные маркеры HBV определяются в клинической практике методом ИФА и позволяют правильно определить тактику лечения острого и хронического гепатита В.

Определение ДНК вирусного гепатита В

Определение ДНК HBV – тест на присутствие ДНК вируса гепатита В у пациента в крови методом ПЦР.

Положительный тест означает, что вирус активно размножается в организме человека и такой человек несет потенциальную опасность заражения вирусом гепатита В.

Количественное определение ДНК HBV (вирусная нагрузка) – это тест на определение количества единиц ДНК вируса гепатита В, которые присутствуют в определенном объеме крови.

Количественный метод определения содержания ДНК вируса в плазме дает важную информацию об интенсивности развития заболевания, об эффективности лекарственной терапии и о развитии резистентности к антивирусным препаратам. От вирусной нагрузки зависят не только дозы препаратов, но и длительность лечения и прогнозы.

Лечение вирусного гепатита В

Основу лечения вирусного гепатита В составляют противовирусные препараты. Цель этого лечения – подавление размножения вируса, снижение воспаления и регресс фиброзного процесса, профилактика цирроза и рака.

Для лечения хронического гепатита В используются препараты интерферона и аналоги нуклеозидов. Тактику лечения теми или иными препаратами определяет лечащий врач в зависимости от целого ряда обстоятельств, в первую очередь, активности вирусного процесса, а также состояния печени по данным биохимических анализов, УЗИ и степени фиброза. Для определения степени фиброза существуют безопасные и информативные методы – эластометерия (на специальном аппарате) и фибротест (по маркерам фиброза в крови).

В настоящее время в клиническую практику внедрены современные противовирусные препараты прямого антивирусного действия – аналоги нуклеозидов, которые вводятся в виде таблеток, быстро и эффективно подавляют размножение вируса. Большинство из них не имеет выраженных побочных действий, что выгодно отличает их от интерферонов.

Вирус гепатита В может сопровождаться вирусом D, который попадает в организм человека только вместе с вирусом В. Этот вирус быстро и часто вызывает в печени необратимые изменения и требует назначения противовирусной терапии как можно раньше для предотвращения формирования цирроза.

Лечение вирусного гепатита В длительное, повторяющимися курсами, если вирус активируется после успешно проведенного курса противовирусного лечения. Вирус гепатита В требует пожизненного контроля. Только в этом случае можно сохранить навсегда нормальную здоровую печень без цирроза или рака печени. С вирусным гепатитом В можно успешно бороться.

В медицинском центре «Биомедика» нашим пациентам могут быть выполнены все необходимые лабораторные исследования на определение вируса гепатита В, сделаны УЗИ органов брюшной полости и проведена консультация врача-инфекциониста (гепатолога). Наши специалисты имеют высшую квалификационную категорию, регулярно участвуют в международных конференциях гепатологов и имеют клинический опыт современной терапии хронического гепатита В.

Вопросы и ответы – «ГЕПАТИТ.РУ»

  1. Главная
  2. Вопросы и ответы



Вопрос: у меня 22 недели беременности, получила ответ на анализ крови на гепатит, вот что он показал: ПЦР диагностика гепатита С — ОТРИЦАТЕЛЬНАЯ, антитела к вирусу гепатита С — спектр (ИФА) СЛАБО положительный, cor(+), ns3(-), ns4(-), ns5(-), антитела к вирусу гепатита С суммарные (ИФА) положительный. получаеться у меня гепатит С?

Ответ: Наличие антител, тем более сомнительных, не означает диагноз гепатит С. Надо перепроверить еще раз и сделать анализ ПЦР.

Вопрос: Добрый день! В 2007 году был острый гепатит В, при выписке анти-HBsAg 2,161(0,111),все остальные показатели отрицательные. Через 7 месяцев анти-HBsAg 0,240(0,107), все остальные отрицательные, в том числе и HBV. Меня сняли с учета. Теперь беременность 30 недель, повысился биллирубин, терапевт ставит под вопросом синдром Жильбера, гепатолог говорит, что даже при всех тех давних результатах на гепатит В, не исключена его хронизация . Подскажите, пожалуйста, возможна ли хронизация гепатита В? И стоит ли сдать снова анализы? Заранее благодарна.

Ответ: О хроническом вирусном гепатите В можно говорить только в том случае, если у вас HBsAg положительный. Возможно скрытое течение вирусного гепатита В в случае, если острый вирусный гепатит закончился без формирования иммунитета — anti-HBs отрицательный. В этом случае среди маркеров гепатита должен обнаруживаться anti-HBcor, может быть и anti-HBe.
Если есть подозрение на синдром Жильбера, то надо сделать генетический анализ.

Вопрос: Здравствуйте! Мой доктор поставил диагноз: хронический вирусный гепатит С после того как я сдал анализ: core-NS 3,5 сумм. — положительно. Теперь мне надо сдать анализ PCR RNA HCV количеств. Надо было перед этим анализом сдавать еще PCR RNA HCV качествен. или количеств. все сразу покажет. За ранее спасибо

Ответ: Если качественный анализ будет отрицательный, то количественный делать бессмысленно при отсутствии вируса.

Вопрос: Здравствуйте! Скажите пожалуйста,мне на днях поставили первую прививку от гепатита В,а сегодня я нашла свою карту о прививках и выяснилось,что мне их уже ставили в 2007году,но я об этом совсем забыла.Повторная прививка как-то может навредить моему здоровью,если эти прививки мне уже были поставлены ранее.Заранее спасибо

Ответ: Нет, не повредит. Но на всякий случай сделайте анализ anti-HBs количественный, что бы определить, действует ли ваша прививка, Количество антител должно быть больше 100. Если меньше, то надо делать прививку заново.

Вопрос: Здравствуйте! У меня хронический гепатит В с 2011 года, прохожу курс ПВТ препаратом СЕБИВО, по 1 табл в день. ПЦР- сразу через 3месяца после начала приема. Но сейчас ощущаю на себе побочки. Делала узи щитовидной железы, сдавала кровь на гормоны, в итоге-диффузный зоб. Гормоны в норме, а узи показывает увеличение щитовидки. В «женской части»-кольпит, и подозрение на воспаление либо эндометриоз. Узи брюшной полости показало-хронический холецистит. Возможно ли дальше продолжать ПВТ? И можно ли во время ПВТ одновременно лечить остальные заболевания?
Результаты моего последнего исследования: вирус гепатита В(колич)-не обнаружен, референсные значения-не обнаружен. anti HBcor total- положительный. anti- HBS(колич.)-0 мЕд/мл. anti-HBe-положительный.

Ответ: В вашей ситуации для продолжения терапии надо оценивать степень фиброза. Я не встречалась со случаями побочного действия аналогов нуклеозидов на щитовидную железу и другими перечисленными вами. Лечить их обязательно нужно без всякой зависимости от вирусного гепатита. Те анализы, которые вы делали для контроля эффективности не имеет смысла делать, они не изменятся.

Вопрос: Моему близкому родственнику был установлен диагноз гепатит с, и так же были снижены тромбоциты, отослали к гематологу, где врач прописал гормональные преднизалон, но при снижении дозы тромбоциты так же падают. И врач кроме преднизалона не может не чего сделать. Соотвественно лечение гепатита с при сниженных тромбоцитах врач не начинает замкнутый круг, узи печени показал что все в норме. Подскажите что делать

Ответ: Найти грамотного гепатолога. Если в печени все в порядке, то тромбоциты падают не из-за печени. При низком фиброзе нет необходимости начинать ПВТ в такой ситуации.

Всего: 12 страниц


Вы можете задать вопрос на нашем форуме

HBsAg подтверждающий – что это такое? Свойства и показания

Материал для исследования: сыворотка крови.

Метод определения: твердофазный иммуноферментный анализ (ELISA).

Исследование проводится с использованием тест системы производства Вектор Бест (Россия).

Вирусный гепатит В — ДНК — содержащий вирус. Имеет несколько антигенов — HВsAg — поверхностный антиген, HBcAg — сердцевинный антиген, HBeAg — антиген инфекционности.

HBsAg — поверхностный антиген вируса гепатита В, основной маркер острого и хронического гепатита В — представляет собой белковую молекулу (липопротеин), ответственную за адсорбцию вируса на поверхности гепатоцитов (клеток печени). После встраивания вируса в геном печеночных клеток они начинают продуцировать вирусную ДНК и белки, и новые молекулы HBsAg поступают в кровь.

В большинстве случаев HBsAg обнаруживается уже в инкубационном периоде и при остром течении гепатита выявляется в крови в течение 5-6 мес. Обнаружение поверхностного антигена вируса гепатита В в крови дольше 6 месяцев после начала болезни свидетельствует о возможной хронизации процесса. Возможно пожизненное носительство HBsAg. HBsAg способен активизировать клеточные протоонкогены. Через достаточно длительный срок (более 20 лет) возможно развитие гепатокарциномы.

Поверхностные (HBs-Ag) и сердцевинные (HBc-Ag) белки вируса являются антигенами, обусловливая выработку антител anti-HBs и anti-HBs-core соответственно. Сердцевинный антиген, попадая в кровь, расщепляется на более устойчивые составные части, одна из которых HBe-Ag также несет антигенные свойства. На нее и вырабатываются anti-HBe антитела. Генетическая изменчивость HВV способствует «ускользанию» вируса из-под иммунного ответа. С этим связаны трудности в лабораторной диагностике (серонегативный гепатит В), а также хронизация заболевания.

Подготовка к исследованию: Не требуется.

Исследование проводится в случае обнаружения в сыворотке HBs-антигена. Подтверждающее исследование включает повтор теста на HBsAg и пробы с иммуноингибированием и разведением. При подтверждении первичного положительного результата выдается ответ: HBsAg — «положительно», HBsAg (подтверждающий) — «положительно».

В редких случаях при проведении подтверждающего теста проба с иммуноингибированием не подтверждает специфичности положительного результата. В таких случаях выдается ответ HBsAg — «результат повторно положительный, неподтвержденный». Это означает вероятность каких-либо неспецифических влияний компонентов сыворотки. В таком случае рекомендуется через некоторое время повторить тестирование.

Общие сведения о тесте на поверхностные антитела к гепатиту B

Тест на поверхностные антитела к гепатиту B (HBsAb) ищет антитела, которые ваша иммунная система вырабатывает в ответ на поверхностный белок вируса гепатита B. Поверхностные антитела против гепатита B также называют анти-HBs, и их не следует путать с HBsAg, что означает поверхностный антиген гепатита B.

ERproductions Ltd / Getty Images

Что такое поверхностные антитела к гепатиту В?

Когда вы подвергаетесь воздействию гепатита B, ваше тело вырабатывает иммунную реакцию против него как захватчика.Это происходит независимо от того, подверглись ли вы контакту с кровью или половым путем, или если вы вакцинированы вакциной против гепатита В.

Вирус гепатита В имеет на своей поверхности белки (антигены), которые заставляют вашу иммунную систему вырабатывать антитела. В вакцине образец содержит только белок, а не сам вирус.

Первая реакция вашего организма при контакте с гепатитом B — это выработка антител IgM к гепатиту B . Эти ранние антитела вырабатываются для борьбы с несколькими частями вируса, включая его ядро.Эти антитела видны при первоначальном ответе, но в конечном итоге они исчезают.

Затем ваша иммунная система начинает вырабатывать антител IgG . Он продолжает вырабатывать эти антитела всю оставшуюся жизнь. Таким образом, ваша иммунная система всегда готова атаковать вирус гепатита B.

Цель теста

Этот тест на HBsAb может быть проведен, чтобы выяснить, ранее был ли он заражен гепатитом B или была ли ваша вакцинация успешной.Это также можно сделать, если у вас гепатит В, чтобы увидеть, выздоравливаете ли вы.

Несмотря на то, что вакцинация младенцев и детей от гепатита B является стандартом (с 1991 г.), многие взрослые не были вакцинированы в детстве и могут подвергаться риску. Также возможно, что ваши уровни антител снизятся с годами, и если результаты теста отрицательный, может понадобиться бустер.

Как проводится тест

Тест на HBsAb проводится путем взятия образца крови, который отправляется в лабораторию для анализа.Ваш врач получит результаты и оценит их с учетом вашей истории вакцинации, риска заражения, симптомов и результатов других тестов на гепатит.

Интерпретация результатов

Ваш тест может быть положительным или отрицательным, но результаты также могут интерпретироваться по-разному в зависимости от других выполненных тестов на гепатит.

Положительно

Если HBsAb положительный (присутствуют антитела), это обычно означает, что вы излечились от инфекции гепатита B и имеете некоторый иммунитет или что вы когда-то получали вакцинацию против гепатита B и имеете иммунитет.Взаимодействие с другими людьми

отрицательный

Если ваш тест на HBsAb отрицательный, это может означать много разных вещей, но в целом это означает, что у вас нет иммунитета к вирусу гепатита B.

Если ваши другие тесты на гепатит В (как на HBsAb, так и на другие тесты на гепатит) отрицательны, это означает, что вы либо не инфицированы, либо находитесь на очень ранней стадии инкубации инфекции, до того момента, когда будут образовываться антитела.

Если ваш тест на HBsAb отрицательный, ваш врач может порекомендовать вам вакцину.

отрицательно, но другие анализы на гепатит положительны

Ваш тест на HBsAb может быть отрицательным, даже если другие тесты на гепатит B положительны, показывая активную или хроническую инфекцию. Необходимы дальнейшие тесты, особенно на поверхностный антиген гепатита B (HBsAg), который показывает, что сам вирус циркулирует в вашем кровотоке. и что у вас активная или хроническая инфекция.

Продолжение

Спросите своего врача, есть ли у вас дополнительные вопросы о тесте и о том, почему он проводится.Если ваш HBsAb положительный, это означает, что вы были инфицированы в прошлом или получили вакцину и теперь у вас иммунитет.

Многие люди, инфицированные вирусом гепатита B, не имеют очевидных факторов риска заражения. Для передачи вируса требуется лишь небольшое количество крови (подумайте: открытая рана на руке, касающаяся предмета, который болезнь, возможно, задела). Даже совместного использования зубной щетки или поцелуев достаточно, чтобы передать инфекцию.

Если ваш тест на HBsAb отрицательный, но другие тесты на гепатит положительны, вашему врачу потребуется дополнительное обследование.Возможно, у вас активная инфекция, за которой следует внимательно следить, или у вас сейчас развилась хроническая инфекция гепатита B.

Хронические инфекции могут привести к осложнениям, некоторые из которых могут быть такими серьезными, как цирроз или рак печени, поэтому очень важно проконсультироваться с врачом и разработать план действий, будь то лечение или тщательный мониторинг.

Слово от Verywell

Если все ваши тесты на гепатит отрицательны, это означает, что вы не подвергались воздействию вируса (или не получали прививку) и не имеете иммунитета.В этом случае поговорите со своим врачом о вакцинации, о том, есть ли у вас факторы риска заражения гепатитом В.

В заключение, даже те, кто имеет иммунитет к гепатиту B благодаря иммунизации, все еще подвержены риску заражения другими типами гепатита.

Что такое Anti-HBS, что означает положительный и отрицательный Anti-HBS?

Гепатит В или, другими словами, желтуха — это вирусное заболевание печени. Вирус гепатита B (HBV) может передаваться через кровь, половым путем или может передаваться ребенку в утробе матери, он может развиваться как острый или хронический.После передачи гепатита в организм в течение 6 недель — 6 месяцев у вас могут появиться такие симптомы, как грипп, и другие симптомы могут не проявляться. Лабораторный тест показывает, что если HBsAG положительный, это означает, что поверхностный антиген гепатита B указывает на то, что человек инфицирован, в то время как Anti-HBS указывает на то, что у человека выработался иммунитет к болезни.

Если у человека был вирус гепатита В, переданный ранее или если человек был вакцинирован, положительные уровни Anti-HBS определены лабораторными тестами.

Что такое Anti-HBS?

Вирус гепатита В, вызывающий воспалительную инфекцию в печени; Он передается от человека к человеку при половом акте, контакте с биологическими жидкостями, нестерильными средствами по уходу за телом и кровью. Вирус гепатита В, который может передаваться от матери к плоду во время беременности, представляет собой опасное для жизни заболевание, которое нарушает работу печени. Anti-RLS — это лабораторный тест, позволяющий определить, вырабатывает ли в организме человека, предположительно инфицированного вирусом гепатита B, защитный белок против поверхностного антигена гепатита B.Проще говоря, Anti RLS также можно определить как тест для определения иммунитета человека к вирусу гепатита B. Когда человек сталкивается с вирусом гепатита В, иммунная система пытается обнаружить и уничтожить вирус. Для этого он производит антитела против антигена, идентифицированного как HBsAG, на поверхности вируса гепатита B. Положительное значение анти-HBC IGG указывает на то, что пожизненный иммунитет достигается за счет антител, вырабатываемых после первых антител, образовавшихся после контакта с вирусом гепатита B.

Значение Anti HBC IGG, которое не дает информации о выздоровлении или хроническом течении болезни, поэтому не имеет самостоятельного значения. Эти антитела, которые вырабатываются организмом и образуют защитный механизм, называются Anti-HBS. Анти-HBA — это продукт борьбы организма с вирусом гепатита B, который знаменует полное исчезновение инфекции. Эти антитела также обеспечивают постоянный иммунитет в организме. Затем организм готов вырабатывать антитела против антигенов, присутствующих на поверхности вируса, когда он сталкивается с вирусом гепатита B.Другими словами, болезнь уничтожается организмом до того, как она вызовет инфекцию. Измеряя уровень этих антител в организме в лаборатории, значение Anti-RLS дает положительный или отрицательный результат.

Цель теста Anti-HBS — определить, был ли человек ранее инфицирован или вакцинирован от вируса гепатита B. В некоторых случаях, например при неполной вакцинации, уровень антител может снижаться, поэтому этот тест можно использовать для определения необходимости повторной вакцинации.Для анти-HBS врач берет кровь у пациента и отправляет ее в лабораторию для анализа и оценивает ее вместе с результатом теста на гепатит.

Что означает положительный результат «Анти-HBS»?

Anti-HBS — это тип лабораторного теста, который проводится на людях, предположительно больных гепатитом B. Тест, который можно использовать для определения того, был ли человек уже иммунизирован путем воздействия вируса гепатита B или вакцинации, может также может использоваться для определения того, был ли вирус уничтожен организмом и приобрел ли иммунитет на всю жизнь.Тест на анти-HBS также используется для проверки того, сохраняется ли вакцина или, другими словами, вырабатывает ли организм антитела против HBsAG, который определяется как поверхностный антиген вируса гепатита B. Перед введением вакцины против гепатита B также проводится тест на анти-RLS, чтобы определить, обладает ли человек иммунитетом к этому вирусу.

На вопрос «что является положительным по отношению к HBS *» можно ответить следующим образом; Результат лабораторного теста, проведенного с помощью метода анализа крови, известного как Elisa, показывает, что значение анти-HBS положительное, что указывает на то, что человек невосприимчив к вирусу гепатита B.Положительное значение анти-HBS, которое указывает на то, что человек защищен от вируса гепатита B на всю жизнь, может быть получено путем вакцинации или вследствие инфекции. Хотя значение анти-HBS выше 5 мМЕ / мл, оно считается положительным, но значение от 5 до 12 мМЕ / мл после вакцинации показывает, что вакцина не сохраняется. Значения выше 12 мМЕ / мл указывают на то, что вакцина сохраняется и полностью иммунизируется. Тест на анти-RLS не определяет, был ли иммунитет приобретен после контакта с вирусом гепатита B или после вакцинации.Чтобы понять это, необходим тест Anti Hepatitis Core, известный как Anti HBC.

Что означает положительный результат «Анти-HBS»?

Когда результат анти-HBS получен лабораторным тестом, отрицательное значение означает, что в организме нет иммунитета против вируса гепатита B. Таким образом можно ответить на часто задаваемый вопрос: «Что означает отрицательный результат анти-HBS?». Для людей, не получивших вакцину против гепатита B, вполне нормально иметь анти-HBS. Однако тот факт, что отрицательный результат Anti-HBS не означает, что человек не болеет гепатитом B и не заражен инфекцией.Чтобы понять это состояние, необходимо проверить уровень HBsAg, известный как тест на поверхностный антиген гепатита B. Отрицательное значение, полученное по уровню анти-HBS в 5,0 мМЕ / мл, указывает на то, что организм не вырабатывает антитела против антигена, идентифицированного как HBsAG, на поверхности вируса гепатита B в присутствии гепатита B из-за острого или хронического гепатита. Рекомендуется вакцинировать человека в случае отрицательного значения анти-HBS, что свидетельствует о том, что человек не подвергался воздействию вируса гепатита B или не был вакцинирован ранее.Гепатит B, распространенность которого во всем мире составляет 5%, может привести к смертельным заболеваниям, таким как рак печени, и пациенту напоминают, что он может легко получить защиту с помощью вакцинации.

Результат Anti-HBS

Тест

Anti-HBS используется для проверки того, подвергался ли человек воздействию вируса гепатита B раньше, и обеспечивала ли вакцина против гепатита B защиту с помощью лабораторного теста. Анти-HBS, который принимается примерно через два дня после сдачи крови, четко определяет, имеет ли человек иммунитет к вирусу гепатита B.Результат теста включает референсный диапазон Anti-HBS и положительные или отрицательные значения, указывающие результат теста. Значения ниже 5,0 мМЕ / мл считаются отрицательными, а результаты выше этого значения — положительными. Однако вакцина против вируса гепатита B должна быть 12 мМЕ / мл и выше для полной защиты.
Если у вас есть дополнительные вопросы о вирусе гепатита B и тесте на анти-HBS, вы можете связаться с нами по телефону 0090 216 444 39 49 .

Влияние вариантов детерминанта «а»

Abstract

При хроническом гепатите В (ХГВ) устойчивость поверхностного антигена гепатита В (HBs Ag) иногда ассоциируется с антителами (Ab) к HBs (анти-HBs).Чтобы оценить гипотезу выбора вариантов иммунного ускользания HBs Ag у пациентов с ХГВ, вариабельность гена S HBV была определена для пациентов, постоянно несущих как HBs Ag, так и анти-HBs антитела, и пациентов, исключительно положительных по HBs Ag. Мы отобрали 14 пациентов, у которых были представлены оба маркера (группа I) в нескольких последовательных образцах, и 12 пациентов, положительных только по HBs Ag (группа II). Ген, кодирующий HBs Ag, был амплифицирован и клонирован, и по меньшей мере 15 клонов на пациента были секвенированы и проанализированы.Количество изменений остатков в S-белке было в 2,7 раза чаще у пациентов группы I, чем у пациентов группы II, и происходило в основном в детерминанте «а» главной гидрофильной области (MHR), с 9,52 против 2,43 изменений на 100 остатков ( P = 0,009) соответственно. Десять пациентов (71%) из группы I и только трое (25%) из группы II показали как минимум два остаточных изменения MHR. Наиболее частые изменения у пациентов группы I были расположены в положениях s145, s129, s126, s144 и s123, как описано для вариантов иммунного ускользания.У пациентов с ХГВ сосуществование HBs Ag и анти-HBs Ab связано с увеличением вариабельности детерминанты «a», что предполагает отбор мутантов иммунного ускользания HBV во время хронического носительства. Последствия этого процесса отбора в отношении эффективности вакцины, диагностики и клинической эволюции остаются частично неизвестными.

Более 350 миллионов человек, или 5% населения мира, являются хроническими носителями вируса гепатита B (HBV), и эта инфекция представляет собой глобальную проблему общественного здравоохранения (21).У многих пациентов, хронически инфицированных HBV, что определяется по сохранению более 6 месяцев поверхностного антигена гепатита B (HBs Ag), разовьются опасные для жизни заболевания, такие как цирроз печени и гепатоцеллюлярная карцинома. Было подсчитано, что до 30% из них умрут от последствий заражения (20).

При естественном течении инфекции HBV выведение вируса, вероятно, является результатом тесной координации как гуморальной, так и клеточной иммунной систем. В целом, опосредованный антителами иммунный ответ на белки HBV направлен на удаление циркулирующих частиц HBV, тогда как клеточные эффекторы вносят вклад в устранение инфицированных гепатоцитов (30).Биологически клиренс вируса классически характеризуется появлением анти-HBs-антител (Ab) в серологическом профиле.

При хронической инфекции гепатита В можно выделить две клинически важные фазы. В то время как фаза иммунной толерантности обычно характеризуется небольшим повреждением печени и присутствием е-антигена гепатита В (HBe Ag) в сыворотке, вторую фазу можно охарактеризовать как более агрессивную для печени, с отбором HBe Ag-отрицательных вариантов и обнаружение антител к HBe.В конечном итоге хронические носители могут быть классифицированы как неактивные носители с низкой репликацией вируса и антителами к HBe и нормальными биохимическими маркерами печени или как пациенты с хроническим гепатитом с аномальными уровнями ферментов печени и более высокой вирусной нагрузкой (23).

Примечательно, что в нескольких отчетах описана персистенция HBs-Ag, связанного с анти-HBs-антителами, у 10–25% пациентов с хроническим гепатитом B (ХГВ) (19, 27). Механизм, лежащий в основе присутствия как HBs Ag, так и анти-HBs антител, остается неизвестным, но одной из возможностей может быть отбор мутантов, ускользающих от иммунитета.

Ген оболочки HBV имеет три открытые рамки считывания (ORF), PreS1, PreS2 и S, которые кодируют три белка, малый, средний и большой HBs Ag, транслируемые с разных мРНК. Общий для всех трех белков доминантный эпитоп «а» расположен в положениях кодонов от 124 до 147 в основной гидрофильной области (MHR) гена S. Эта детерминанта является одной из основных мишеней анти-HBs-антител в ходе начального иммунного ответа при остром гепатите B.

В результате могут появиться иммунные варианты HBs Ag с мутациями в одном или нескольких сайтах детерминанты «а». селективного давления на белок S.Действительно, эти ускользающие мутанты в основном возникают у вакцинированных пациентов или у пациентов с ортотопической трансплантацией печени, получавших моноклональные или поликлональные антитела к HBs Ag (5, 7, 11). Некоторые из распространенных изменений остатков Ag HBs для иммунного ускользания включают G145R, D144A, P142S, Q129H I / T126N / A и M133L (36). Эксперименты по сайт-направленному мутагенезу, в которых каждая аминокислота была заменена всеми другими возможными остатками, с тех пор подтвердили, что аминокислоты в положениях с 141 по 145 имеют решающее значение для связывания антител против HBs, индуцированных рекомбинантной вакциной против HBV (33).Более того, ускользающая мутация в детерминанте «а» может также возникать при естественном течении инфекции HBV, что приводит к активной репликации вируса и заболеванию печени, несмотря на сероконверсию в анти-HBs у пациентов с хроническим гепатитом B (1, 13, 25, 28, 38, 39). Аналогичным образом, в нескольких отчетах были идентифицированы мутанты HBs Ag в образцах сыворотки, которые дали положительный результат как на HBs Ag, так и на анти-HBs (3, 19, 26). Однако ограничениями этих предыдущих исследований было ограниченное количество клонов или пациентов, рассматриваемых для анализа, и тот факт, что распространенность встречающихся в природе мутаций в детерминанте «а» остается неизвестной для пациентов с ХГВ.Как практическое следствие, обнаружение анти-HBs, связанных с вариантами S, у хронических носителей может привести к ошибочному диагнозу бывшей вирусной инфекции гепатита B, если диагностический тест не может обнаружить мутировавший HBs Ag. Механизм, лежащий в основе появления анти-HBs у пациентов с хроническим гепатитом B, остается неясным, но одной из причин может быть отбор вариантов иммунного ускользания HBs Ag. Чтобы оценить эту гипотезу, вариабельность гена HBV S у носителей ХГВ была определена для пациентов, несущих как HBs Ag, так и анти-HBs антитела, и пациентов, положительных только по HBs Ag.

МАТЕРИАЛЫ И МЕТОДЫ

Пациенты и сыворотки.

Восемьсот шестьдесят шесть пациентов регулярно наблюдаются в больнице Ла-Пити-Сальпетриер по поводу хронического гепатита, определяемого HBs Ag-носительством в течение более 6 месяцев. Хотя подавляющее большинство из них (91,1%) не выработали определяемых антител к HBs во время последующего наблюдения, 77 пациентов (8,9%) одновременно несут как HBs Ag, так и антитела против HBs. Для этого исследования мы протестировали 26 сывороток пациентов с ХГВ, отобранных на основе их статуса антител к HBs.Критерии отбора пациентов как с HBs Ag, так и с анти-HBs были в основном сосредоточены на титрах анти-HBs, по крайней мере, в три раза превышающих аналитический порог метода (10 мМЕ / мл) по крайней мере при трех посещениях подряд.

Обнаружение серологических маркеров HBV.

Измерения HBs Ag, анти-HBs-антител, HBe Ag и анти-HBe-антител проводились с использованием стандартных иммуноферментных анализов на основе микрочастиц (HBs Ag V2.0, anti-HBs V2.0, HBe Ag 2.0 и анти-HBe). -HBe 2.0) (анализ AxSYM; Abbott, Rungis, France). Количественную оценку вирусной нагрузки ДНК HBV проводили с использованием коммерчески доступных анализов Hybrid Capture II Digene (Abbott, Rungis, Франция) и HBV Monitor Cobas (Roche Diagnostics, Meylan, Франция).

Извлечение и амплификация полноразмерного генома HBV.

ДНК HBV экстрагировали из 200 мкл сыворотки каждого пациента с помощью мини-набора QIAmp DNA Blood (QIAGEN, Les Ulis, FRANCE) и собирали в 60 мкл воды. Амплификацию ДНК HBV проводили в соответствии с методом, описанным Günther et al., с небольшими изменениями (12). Вкратце, ПЦР проводили в 50-мкл реакционной смеси, содержащей 10 мкл ДНК-матрицы HBV, 2 мМ MgSO 4 , 0,2 мМ концентрации каждого дезоксинуклеозидтрифосфата, 60 мМ Tris-SO 4 (pH 8,9), 18 мМ (NH 4 ) 2 SO 4 , 0,2 мкМ (каждый) праймеров P1 (5′-CCG GAA AGC TTG AGC TCT TCT TTT TCA CCT CTG CCT AAT CA-3 ‘) и P2 (5’- CCG GAA AGC TTG AGC TCT TCA AAA AGT TGC ATG GTG CTG G-3 ‘) и 1 мкл ДНК-полимеразы высокой точности Taq Platinum (Invitrogen, Cergy-Pontoise, Франция) на термоциклере (двигатель ДНК PTC-200 ; MJ Research).После горячего старта и денатурации при 94 ° C в течение 1,5 мин было выполнено 45 циклов с денатурацией при 94 ° C в течение 30 с, отжигом при 56 ° C в течение 30 с и элонгацией при 68 ° C в течение 3,5 мин.

В случае неудачной амплификации с использованием полноразмерного подхода был разработан метод амплификации гена, кодирующего S-белок. ПЦР с использованием специфических праймеров VTS1 (5′-TTC TTG GAA CAA GAG CTA C-3 ‘) и VT1022 (5′-GCA AAG CCC AAA AGA CCC ACA AT-3’) в тех же условиях, что описаны выше, но с временем элонгации 1 мин выполняли для амплификации полного гена S.

Клонирование полноразмерного генома HBV.

После амплификации ПЦР и электрофореза продукты ПЦР выделяли из агарозного геля, очищали с использованием набора для экстракции геля QIAquick (QIAGEN, Les Ulis, Франция) и клонировали с использованием набора для клонирования ПЦР TOPO XL (Invitrogen, Cergy-Pontoise, Франция). Плазмиды получали с помощью наборов Qiaprep 8 Turbo miniprep (QIAGEN, Les Ulis, Франция).

Секвенирование гена S.

Нуклеотидную последовательность гена S определяли с помощью BigDye Terminator v3.Готовый реакционный набор для 1 цикла секвенирования и запуск на секвенаторе ДНК ABI 3100 (Applied Biosystems, Les Ulis, Франция). Праймеры, использованные для секвенирования S ORF, приведены в таблице. Анализ последовательности выполняли с помощью программного обеспечения Seqscape (Applied Biosystems, Les Ulis, Франция), программного обеспечения Clustal (34a) и программного обеспечения Mutation Master (http://tandem.bu.edu/tools.html). Вкратце, геномные последовательности, полученные для гена S HBV, сравнивали со всеми эталонными последовательностями HBV, используемыми на веб-сайте NCBI, для определения генотипа HBV (www.ncbi.nlm.nih.gov/projects/genotyping/) следующим образом (даны номера доступа): subtype A, {«type»: «entrez-nucleotide», «attrs»: {«text»: «X02763», «term_id»: «59418», «term_text»: «X02763»}} X02763, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X51970», «term_id»: «1155012» , «term_text»: «X51970»}} X51970 и {«type»: «entrez-нуклеотид», «attrs»: {«text»: «AF0

«, «term_id»: «5114084», «term_text»: » AF0

«}} AF0

; подтип B, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «D00329», «term_id»: «221497», «term_text»: «D00329»}} D00329, {«type» : «entrez-нуклеотид», «attrs»: {«text»: «AF100309», «term_id»: «4323201», «term_text»: «AF100309»}} AF100309 и {«type»: «entrez-нуклеотид» , «attrs»: {«текст»: «AB033554», «term_id»: «6063442», «term_text»: «AB033554»}} AB033554; подтип C, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X04615», «term_id»: «59585», «term_text»: «X04615»}} X04615, {«type» : «entrez-нуклеотид», «attrs»: {«text»: «M12906», «term_id»: «474959», «term_text»: «M12906»}} M12906 и {«type»: «entrez-нуклеотид» , «attrs»: {«текст»: «AB014381», «term_id»: «3582357», «term_text»: «AB014381»}} AB014381; подтип D, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X65259», «term_id»: «59439», «term_text»: «X65259»}} X65259 и {«type» : «entrez-nucleotide», «attrs»: {«text»: «X85254», «term_id»: «736003», «term_text»: «X85254»}} X85254; подтип E, {«тип»: «entrez-нуклеотид», «attrs»: {«текст»: «X75657», «term_id»: «452617», «term_text»: «X75657»}} X75657 и AB03243; подтип F, {«тип»: «entrez-нуклеотид», «attrs»: {«текст»: «X69798», «term_id»: «59422», «term_text»: «X69798»}} X69798, {«тип» : «entrez-нуклеотид», «attrs»: {«text»: «AB036910», «term_id»: «11191875», «term_text»: «AB036910»}} AB036910 и {«type»: «entrez-nucleotide» , «attrs»: {«текст»: «AF223965», «term_id»: «12247041», «term_text»: «AF223965»}} AF223965; подтип G, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «AF160501», «term_id»: «6983934», «term_text»: «AF160501»}} AF160501, {«type» : «entrez-нуклеотид», «attrs»: {«text»: «AB064310», «term_id»: «18146661», «term_text»: «AB064310»}} AB064310 и {«type»: «entrez-nucleotide» , «attrs»: {«текст»: «AF405706», «term_id»: «19849032», «term_text»: «AF405706»}} AF405706; и подтип H, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «AY0

«, «term_id»: «22135696», «term_text»: «AY0

«}} AY0

, {«type «:» entrez-нуклеотид «,» attrs «: {» text «:» AY0

«,» term_id «:» 22135711 «,» term_text «:» AY0

«}} AY0

и {» type «:» entrez-нуклеотид «,» attrs «: {» текст «:» AY0

«,» term_id «:» 22135726 «,» term_text «:» AY0

«}} AY0

.

ТАБЛИЦА 1.

Обзор праймеров для амплификации и секвенирования, используемых в данном исследовании

56-64

9017AGS Ag / Pol

9017AGGAT / Pol

Праймер Последовательность (5′-3 ‘) Полярность a Домен Позиции
VTS1 TTCTTGGAACAAGAGCTAC S / Pol пре S1

2831-2850
CHBV3 CCTGCTGGTGGCTCCAGTT S / preS2 Pol
VT301 CTTGGCCAAAATTCGCAGTCCCC S HBs Ag / Pol 299-311
SEQ11REV GAGCAGGAGTCGTGCAGGT AS HBs Ag / Pol 521-539 521-539 997-1019

Статистический анализ.

Сравнения проводились с использованием теста Манна-Уитни или теста t для количественных данных. Статистическая значимость была определена при уровне P <0,05. Данные были проанализированы с использованием NCSS 2001 (Кейсвилл, Юта).

РЕЗУЛЬТАТЫ

Характеристики пациентов.

Среди 864 хронически инфицированных HBV пациентов, наблюдаемых в больнице Ла-Пити-Сальпетриер, 77 (8,9%) были идентифицированы как несущие как HBs Ag, так и анти-HBs антитела в последовательных образцах.Чтобы проанализировать механизмы, лежащие в основе присутствия HBs Ag и анти-HBs у хронически инфицированных пациентов, мы выбрали две группы пациентов на основе их серологического статуса.

Четырнадцать пациентов с ХГВ, у которых при последовательных посещениях были представлены как HBs Ag, так и анти-HBs, составили группу I, в то время как 12 пациентов с ХГВ, положительных только по HBs Ag, представляли группу II. Согласно классическому описанию, все пациенты были также положительны на другие маркеры инфекции HBV, такие как anti-HBc и HBe Ag или anti-HBe.Важно отметить, что, как указано в таблице, уровни анти-HBs у пациентов из группы I были довольно высокими, со средним титром 81 МЕ / л (диапазон от 43 до 512).

ТАБЛИЦА 2.

Основные характеристики пациента a

901 907 907 901

9017

9017

+

9017

901

901

901

901

9017

80 P

9017 901 LAM / ADV

907

9017

9017

Группа ( n ) Пациент Серологические маркеры


Вирусная нагрузка (лог-копий / мл) Генотип Последующее наблюдение (мес) Предыдущее или текущее лечение


Мутации, связанные с устойчивостью к ламивудину
HBs Ag Титр антител к HBs (МЕ / литр) HBe Ag Anti-HBe Интерферон Нуклеозид

2 аналог нуклеозида

2
I (14) P1 + 43 + > 6 D 8 LAM
9017 512 + + > 6 A 43 LAM
P1 + E 33 LAM L180M / M204V
P7 + 105 + > 6 C 29
P10 + 72 + 3
P11 + 46 + 3.9 C 16 LAM V173L / L180M / M204V
P12 + 286 +
P13 + 48 + > 6 E 25 62 + > 6 A 8
P16 + B 102 Есть
P17 + 47 + > 6 C 36 Да
P18 + 101 + > 6
P20 + 127 + 3.6 A, E 24
P21 + 434 + C C
II (12) P1 + <10 + + > 6 E 24 Да L172 LAM P2 + <10 + + > 6 B 36 LAM
+ > 6 C 42 Да LAM / ADV L180M / M204V
P5 + <10177 + > 6 D 39
P6 + <10 + + + + + 9 E 49 Да LAM
P7 + <10 + 1 9017 9017 907 901

6
P8 + <10 + 4.9 B 43 <10 + > 6 B 46 Есть LAM / ADV L180M / M204I
P 5 C 28
P11 + <10 + > 6 B 49 Да LAM / ADV L180M / M204V
P12 + <10 60
P13 + <10 + > 6 E 36 E 36

Две группы были сопоставимы по статусу HBe Ag (9 HBe Ag-позитивных пациентов в каждой группе), статусу анти-HBe антител (6 пациентов в обеих группах) и вирусной нагрузке выше 6 log копий / мл (10 и 11 пациентов I и II групп соответственно).Сохранение неизменного серологического статуса также принималось во внимание при отборе пациентов, что продемонстрировано медианным статусом HBs Ag при последующем наблюдении в течение 35 и 92 месяцев для пациентов из групп I и II, соответственно. Распределение генотипов HBV было неоднородным в обеих группах, и в группе I наблюдались две коинфекции разных генотипов. Девять пациентов из группы I и восемь пациентов из группы II получали лечение от своих инфекций либо интерфероном, либо аналогом нуклеозида (или нуклеотида). .Что еще более важно, у двух пациентов из группы I и у четырех пациентов из группы II развилась устойчивость к ламивудину, о чем свидетельствует наличие мутаций устойчивости к ламивудину в гене полимеразы.

Секвенирование S-области HBV и статистическое сравнение.

Подход клонирования-секвенирования был использован для изучения полных последовательностей S-кодирующих генов для пациентов из каждой группы. Две пары праймеров были сконструированы для обеспечения возможности амплификации всего S-гена и, из-за перекрытия ORF, N-конца гена, кодирующего полимеразу.Сначала было выполнено сравнение всех последовательностей клонов от каждого пациента; затем все последовательности клонов, полученные от уникального пациента, сравнивали с согласованной последовательностью того же генотипа для выявления необычных остатков. Чтобы стандартизировать наше сравнение, мы произвольно выбрали в качестве эталонных последовательностей те, которые используются в инструменте генотипирования NCBI (www.ncbi.nlm.nih.gov/projects/genotyping/) (31).

Были проанализированы полноразмерные последовательности, полученные из всех клонов, и процент замен остатков сравнили между двумя группами (рис.). Распределение изменений было неоднородным по S ORF, и изменения были более преобладающими для группы I, чем для группы II. Для простоты представления полноразмерный S-белок (226 аминокислот [аа]) далее был разделен на три области: N-концевую область (от 1 до 99 аминокислот), MHR (от 100 до 169 аминокислот), которая содержит детерминант «а» (от 124 до 147 аминокислот) и С-концевой участок (от 170 до 226 аминокислот) (34, 35). Наиболее яркое накопление остаточных изменений наблюдалось в области, охватывающей детерминант «а».В этой области количество замен остатков для группы I было в два-четыре раза выше, чем для группы II.

Частоты замен остатков в S-белке в изолятах от пациентов с HBs Ag / анти-HBs (группа I) (черные столбцы, n = 14) и только HBs Ag-положительных пациентов (серые столбцы, n = 12 ), анализируемых с интервалами по 10 аминокислот в каждом. Каждая полоса представляет собой процент мутировавших остатков для всех клонов в каждом интервале из 10 аминокислот на группу.Изменения остатков, связанные с генотипическим полиморфизмом, не учитывались. Две перекрывающиеся рамки белков S и полимеразы представлены в нижней части диаграммы.

Общий анализ последовательностей белка S для каждого пациента, независимо от серологического статуса, подтвердил гетерогенное распределение изменений остатков. Действительно, самая высокая частота изменений остатков наблюдалась в пределах детерминанты «а» (6,25 мутированных остатков на 100 аминокислот). MHR (3.74 мутантных остатка на 100 аминокислот) и С-концевая часть белка (3,58 мутантных остатка на 100 аминокислот) показали меньшую вариабельность, но немного больше, чем у N-концевой области (2,64 мутантных остатка на 100 аминокислот). (Таблица ). Для статистического анализа N-концевой участок был взят в качестве фонового уровня вариабельности, поскольку он, вероятно, меньше подвержен влиянию иммунного давления или противовирусного лечения.

ТАБЛИЦА 3.

Распределение аминокислотных изменений в полноразмерном S-белке и его различных областях

Кроме того, сравнение вариабельности по S-белку показало заметную разницу между пациентами в группах I и II (рис.; Таблица ). При рассмотрении полноразмерной кодирующей области S количество мутированных остатков у пациентов группы I было заметно увеличено по сравнению с пациентами группы II (4,55 против 1,66 замен на 100 аминокислот; P = 0,009) (таблица). Важно отметить, что распределение аминокислотного обмена вдоль S-белка показало, что изменения остатков происходили в основном в пределах MHR, на уровне 5,71 против 1,43 мутантных остатков на 100 аминокислот ( P = 0,004) для групп I и II, соответственно.Это различие было еще более разительным для детерминанты «а» (9,52 против 2,43 мутантных остатков на 100 аминокислот; P = 0,009) (таблица). Эти результаты показывают, что присутствие анти-HBs одновременно с HBs Ag связано с накоплением мутированных остатков, в основном, но не только, внутри антигенных петель. Для С-концевой области S-белка частоты изменения остатков между группами I и II были сопоставимы (3,88 по сравнению с 3,22 замен на 100 аминокислот; P не было значимым).Следует отметить, что эта область перекрывает ORF полимеразы и, вероятно, была затронута мутациями устойчивости, вызванными противовирусным лечением.

Накопление нескольких остаточных изменений у пациентов группы I в пределах детерминанты «а» также было намного более частым, чем у пациентов группы II (рис.). Действительно, у 10 пациентов (71%) из группы I и только у 3 пациентов (25%) из группы II произошло по крайней мере два изменения остатков в антигенных петлях. Накопление нескольких изменений остатков, вероятно, изменит иммуногенность белка.

Число изменений остатков для пациентов I и II групп в пределах детерминанты «а» МЧСС. Числа 14 пациентов (черные кружки) в группе I и 12 пациентов (светлые кружки) во II группе распределены согласно количеству изменений остатка в детерминанте «а». Статистическая значимость рассчитывалась с использованием критерия Манна-Уитни.

Процент вариантов MHR, заражающих отдельных пациентов, также различается между двумя группами (таблица). Пациенты из группы I, скорее всего, были инфицированы гомогенной популяцией клонов, несущих одну или несколько мутаций.Напротив, пациенты из группы II часто имели небольшую популяцию мутировавшего HBV, причем многие клоны не демонстрировали конкретной мутации. Следует отметить, что для каждого пациента группы I присутствие мутировавших клонов всегда было связано с обнаружением по крайней мере одного клона HBV дикого типа. Интересно, что было замечено, что один и тот же пациент мог быть инфицирован смесью штаммов HBV с несколькими ассоциациями изменений остатков в детерминанте «а» S-белка.

ТАБЛИЦА 4.

Процент вариантов MHR, заражающих пациентов группы I и II

Наиболее частые изменения, наблюдаемые у пациентов с анти-HBs, были расположены в положениях s145, s126 и s129, но изменения также наблюдались во всех петлях 2-4. МПЧ.Кроме того, только пациенты из группы I имели изменения аминокислот G145R, Q129N, I / T126 S / N, D144A и T123N, которые, как известно, изменяют иммуногенность.

Анализ рамки считывания полимеразы.

Для пациентов группы I количество изменений остатков между S и рамками считывания полимеразы сравнивали для перекрывающейся области, охватывающей антигенные петли. Частота изменений остатков была менее важна для полимеразы, чем для рамки считывания S: 1,92 против 3.74 замены на 100 аминокислот ( P = 0,003), соответственно, и эта разница даже усиливалась в перекрывающейся области детерминанты «a» (6,25 против 3,53 замен на 100 аминокислот; P = 0,001). Это различие в замене остатков между HBs Ag и рамками считывания полимеразы не было значимым для пациентов группы II.

Отсутствие различий в С-концевой части S-белка в отношении количества изменений остатков между пациентами в группах I и II, вероятно, объясняется влиянием мутаций устойчивости, обнаруженных в рамке считывания полимеразы.Действительно, два пациента из группы I и четыре пациента из группы II получали ламивудин и у них развились устойчивые к ламивудину штаммы HBV.

ОБСУЖДЕНИЕ

В отличие от того, что обычно описывается как благоприятный исход для ХГВ, приобретение антител против HBs систематически не связано с потерей HBs Ag. Действительно, сосуществование HBs Ag и анти-HBs у хронических носителей вируса гепатита B было описано несколькими авторами для 10–25% пациентов (19, 27).В соответствии с этими исследованиями присутствие HBs Ag и антител было зарегистрировано почти у 9% из 864 носителей вируса хронического гепатита B, наблюдавшихся в нашей больнице. Механизм, лежащий в основе присутствия HBs Ag и анти-HBs, несмотря на репликацию вируса, неизвестен, но одной из причин может быть отбор иммунных вариантов HBs Ag. Действительно, накопление изменений остатков в MHR белка S, основной мишени анти-HBs, может привести к ускользанию от распознавания иммунной системой хозяина.В нескольких исследованиях описаны точечные мутации, приводящие к аминокислотным изменениям в антигенных петлях S-белка в вакцинах и у реципиентов иммуноглобулина против гепатита B (5, 10, 14, 36). Однако мутанты, ускользающие от HBV, также могут возникать естественным образом у хронических носителей вируса гепатита B из-за единственного давления иммунной системы хозяина (13, 19, 22, 25, 26, 28, 39). Эта гипотеза подтверждается результатами нашего исследования, основанного на клональном анализе штаммов HBV, выделенных от пациентов с ХГВ с ( n = 14) или без ( n = 12) анти-HBs.Следует подчеркнуть, что одним из важных критериев отбора наших 14 пациентов в группу I было обнаружение высоких титров анти-HBs в нескольких последовательных образцах, несмотря на обнаруживаемую репликацию вируса.

При сравнении последовательностей HBs Ag из обеих групп поразительно отметить накопление изменений остатков в штаммах от пациентов с Ag / anti-HBs (группа I) по сравнению с носителями HBs, содержащими только Ag (группа II). Более того, распределение этих аминокислотных изменений не было однородным по белку, а скорее собрано в пределах MHR, включая высоко конформационную и богатую цистеином детерминанту «а».Эта область антигенной петли HBs Ag описывается как основная мишень гуморального ответа, и любое изменение ее первичной последовательности может изменить ее антигенную структуру и сделать любую гуморальную защиту против HBs против этой области менее эффективной (29).

Два предыдущих исследования с использованием аналогичного подхода, но на более ограниченном числе пациентов и клонов, охарактеризовали наиболее распространенные остатки, затронутые такими изменениями (19, 39). Таким образом, наиболее вероятно, что позиции 145, 144, 129, 126 и 130 будут изменены.Описание этих изменений остатков, особенно замены G145R, примечательно, потому что эти замены также соответствуют распространенным мутациям, описанным для вариантов ускользания вакцины против HBV или для пациентов, которым терапевтически вводили моноклональные анти-HBs (14, 36). Следует также отметить, что именно эти остатки являются частью петель 3 и 4 MHR и что другие остатки в этих петлях также подверглись дополнительным изменениям. В нашем исследовании наиболее частые изменения остатков в MHR наблюдались в основном у пациентов из группы I с обоими маркерами (71% против 22% пациентов имели более одной мутации), и они в основном включали sG145R, sI / T126N / S, sQ129N и sD144A.Наши результаты сопоставимы с результатами, полученными Ямамото и др. и Kohno et al. но включал большее количество пациентов и клонов на одного пациента. Важно, что изменения остатков, наблюдаемые у пациентов с Ag / anti-HBs, происходят не только в этих характерных положениях, но и во всех петлях 2–4 антигенных петель, но трудно предсказать структурные и биохимические эффекты этих аминокислотных замен. Тем не менее, вероятно, что изменения остатков, расположенные в положении s146, представляющем сайт N-гликозилирования, или s147, местоположении дисульфидного мостика, могут изменить иммунологические свойства белка S (19, 38).В целом, несколько изменений остатков в MHR, которые специфичны для пациентов, несущих как HBs Ag, так и анти-HBs антитела, нуждаются в дальнейшей иммунологической характеристике. Хотя кажется вполне убедительным, что эти изменения могут влиять на распознавание антителами S-белка, очень мало известно о последствиях таких модификаций для распознавания Т-клеточного эпитопа. Как недавно описано Bauer et al. Что касается вакцин, то накопление изменений в эпитопах Т-хелперных клеток пациентов с ХГВ также может влиять на эффективность иммунного ответа и способствовать сохранению вируса (4).

В целом, накопление изменений остатков внутри и вокруг детерминанты «а» может генерировать варианты HBs с изменениями антигенности и, возможно, структуры Т-клеточного эпитопа, что приводит к последующей неспособности нейтрализовать HBV (5). Удивительно, но наши результаты очень похожи на те, которые наблюдались Weinberger et al., Которые описали высокую генетическую изменчивость детерминантной области «a» для HBs Ag-негативных хронических вирусоносителей (38). В первом исследовании пациенты были отобраны на основе реактивности против HBc, и сравнение проводилось в соответствии с обнаружением или отсутствием обнаружения HBs Ag.Из-за различных экспериментальных подходов, то есть прямого секвенирования в исследовании Вайнбергера и клонального анализа в нашей работе, сравнение результатов затруднено. Однако наши результаты подчеркивают повышенную вариабельность белков MHR у Ag / anti-HBs-позитивных пациентов. Обмен аминокислот, обнаруженный Weinberger et al. у HBs Ag-отрицательных пациентов также были обнаружены в некоторых клонах от Ag / anti-HBs-положительных пациентов из нашего исследования. В обоих случаях очень привлекательной гипотезой является отбор мутантов, ускользающих от иммунитета, под сильным иммунным давлением хозяина.

Анализ пациентов группы I выявил наличие вирусной смеси, состоящей из вариантов дикого типа и антигенной петли, что позволяет предположить, что приобретение анти-HBs связано с появлением вариантов ускользания от иммунной системы, сохраняющихся в течение нескольких лет в связи с диким типом вируса. штаммы -типа. Наше исследование предполагает, что наличие вариантов HBs Ag может возникать естественным образом у хронических носителей и, вероятно, является вирусной стратегией, направленной на уклонение от иммунной системы. В свете этой гипотезы возможно, что определяемый HBs Ag (измеренный с помощью диагностического анализа) представляет собой смесь дикого типа и вариантов, тогда как выявляемые анти-HBs-антитела нацелены против вирусов дикого типа.Чтобы исключить систематическую ошибку из-за серологического анализа, используемого для определения анти-HBs, и подтвердить специфичность циркулирующих анти-HBs-антител к антигену HBs дикого типа, титры анти-HBs всех пациентов контролировали с помощью второго анти-HBs. анализ (Monolisa anti-HBs Plus; Bio-Rad, Франция) с очень сопоставимыми результатами (данные не показаны).

Отбор мутантов, ускользающих от иммунитета, во время естественного течения болезни может иметь несколько пагубных последствий. Во-первых, накопление мутированных остатков в MHR может привести к отсутствию распознавания HBs Ag коммерчески доступными диагностическими тестами.Об этой проблеме много писали несколько авторов (9, 37). Действительно, многие анализы не могут обнаружить мутанты G145R, а некоторые из них резко снизили чувствительность к обнаружению других мутантов. Причины такой неудачи зависят от типа антитела (моноклональное или поликлональное) и целевого эпитопа, используемого в анализах, при этом на некоторые тесты в значительной степени влияют мутации внутри петель 2–4 (6, 9, 10, 16, 18).

Во-вторых, накопление HBV, несущих мутации MHR, у пациентов с ХГВ с относительно высокой вирусной нагрузкой поднимает проблему передачи таких вариантов (8, 15).Как упоминалось ранее, варианты MHR не могут быть полностью нейтрализованы вакцино-индуцированными антителами, и у нас до сих пор отсутствуют данные об их возможной передаче вакцинированным субъектам. В свете наших данных хронические носители как Ag, так и анти-HBs могут рассматриваться как потенциальные резервуары вариантов иммунного ускользания. Необходимы дальнейшие эпидемиологические исследования для научной оценки потенциальной угрозы таких хронических носителей в районах высокой эндемичности, где проводится вакцинация младенцев (15).

В-третьих, при скрининге пациента на наличие вакцин-индуцированных антител также может быть полезно предложить по крайней мере обнаружение HBs Ag, поскольку оба маркера могут присутствовать одновременно. Тестирование на антитела к HBc также может быть разумной стратегией.

Мы также отметили, что аминокислоты, расположенные в положениях 122 и 160, которые определяют подтипы d / y и w / r HBs Ag, были полностью консервативными (2). Действительно, аминокислотные замены, расположенные в этих положениях, приводят к изменению подтипа HBs Ag (32).Таким образом, мы можем наблюдать с течением времени у одного и того же пациента одновременное появление частиц HBs Ag определенного подтипа и анти-HBs со специфичностью для другого подтипного детерминанта, не переносимого циркулирующими частицами. Действительно, для пациента 3 (P3), принадлежащего к группе I, не было обнаружено аминокислотных замен ни в одном из протестированных клонов, несмотря на присутствие анти-HBs. Как недавно было продемонстрировано, возможно, что в этом конкретном случае обнаруженные антитела нацелены на ранее присутствующий серотип; однако эту гипотезу можно было исключить только в ходе длительного исследования серийных образцов от одного и того же пациента (24).Этот механизм может быть еще одним способом сохранения вариантов HBV, несмотря на иммунное давление (19, 28).

Хотя в этом исследовании невозможно было полностью оценить естественную историю болезни, сосуществование HBs Ag и анти-HBs, по-видимому, не влияет на развитие болезни. Однако для конкретного решения этой проблемы потребуется более крупное исследование без систематической ошибки отбора, связанной с этнической принадлежностью, продолжительностью инфекции, возрастом инфицирования и генотипом. В свете недавно описанного выбора варианта, не способного к секреции, Калининой и соавт., можно задаться вопросом, связаны ли варианты MHR с определенными формами заболевания (17).

Таким образом, процесс отбора, приводящий к появлению вариантов HBs, можно сравнить с хорошо описанным отбором HBe-отрицательных вариантов в ходе хронического носительства вируса гепатита B.

Долгосрочные результаты двойного положительного результата на HBsAg / анти-HBs по сравнению с однократным положительным результатом на HBsAg с хроническим гепатитом В

В этом исследовании оценивались долгосрочные клинические результаты сосуществования HBsAg и анти-HBs.Доля пациентов с хроническим гепатитом В с двойным положительным результатом на HBsAg / анти-HBs составила 7,0% среди в этом исследовании. Сосуществование HBsAg и анти-HBs было связано с более высоким риском ГЦК и большей серологичностью HBsAg, чем присутствие только HBsAg. Тем не менее, общая смертность существенно не различалась между группами сосуществования и контрольной группой.

Наше исследование показало более высокую частоту двойной положительности HBsAg / anti-HBs, чем сообщалось в предыдущих исследованиях (от 2,8% до 3,6%) 2,3,4,5 .Это могло быть связано с обнаружением двойной положительности во время периода наблюдения. В предыдущем лонгитюдном исследовании аналогичным образом сообщалось о двойной положительности HBsAg / anti-HBs, равной 7,1% 13 . Различия в характеристиках исследуемых популяций также могут влиять на распространенность двойной положительности HBsAg и анти-HBs. Например, делеция pre-S, которая, как считается, связана с сосуществованием HBsAg и анти-HBs, чаще обнаруживается у пациентов с хроническим гепатитом B с генотипом C, чем у пациентов с генотипом B 14,15 .

Есть несколько правдоподобных объяснений сосуществования HBsAg и anti-HBs. Во-первых, отбор мутантов, ускользающих от иммунитета, может происходить во время хронической инфекции HBV, несмотря на продукцию анти-HBs 1 . Мутации или делеции в гене pre-S / S 16 , мутации в детерминанте «a» и других областях белка «S» 17 или появление специфичных для гетерологичных подтипов антител, направленных против подтипов HBsAg, отличных от сосуществующих HBsAg 8,18,19 может объяснить это явление 1 .Во-вторых, еще одно возможное объяснение — суперинфекция новым штаммом HBV 1,20 . Сообщалось также о заражении мутантом, ускользающим от HBV, в присутствии анти-HBs даже после вакцинации 20,21 . В-третьих, реактивация HBV во время скрытой инфекции HBV, часто связанной с иммуносупрессивными состояниями, является еще одним возможным механизмом 22,23 . В-четвертых, ложная положительная реакция на антитела к HBs может объяснить сосуществование HBsAg и анти-HBs, и это явление может происходить в результате воздействия различных естественно развивающихся антигенов или других инфекций, таких как Escherichia coli или Neiserria gonorrhoeae. 24 .Хранение образцов или обращение с ними также может повлиять на ложную положительность анти-HBs. В-пятых, сосуществование HBsAg и анти-HBs может представлять собой возможный переход от HBsAg к выздоровлению к анти-HBs. В этом случае уровень HBsAg и анти-HBs обычно очень низкий, а статус двойного положительного результата на HBsAg / анти-HBs может быть временным. В предыдущих исследованиях также сообщалось о серореверсии HBsAg (повторное появление HBsAg после сероочистки HBsAg) у пациентов, которые испытали серологическое исчезновение HBsAg с положительными анти-HBs 25,26 .Озэки и др. . сообщили о 2 случаях с временно или постоянно положительными анти-HBs во время серореверсии HBsAg, и в этих случаях снова наблюдалась сероочистка HBsAg 27 . Вонг и др. . сообщил об 1 пациенте из 6 пациентов с серореверсией, у которых развились анти-HBs 28 . У этого пациента ДНК HBV не определялась даже после серореверсии к HBsAg-положительному состоянию. При оценке сероочистки HBsAg после терапии аналогами нуклеозидов другое исследование показало, что серореверсия HBsAg имела место у некоторых пациентов, у которых наблюдалась сероочистка HBsAg, большинство из которых были временными с чрезвычайно низкими уровнями HBsAg в сыворотке и ДНК HBV 25 .В соответствии с этими различными механизмами влияние двойной положительности HBsAg / anti-HBs на исходы может быть различным. Однако оценка вирусных мутаций и генетических подтипов в этом исследовании не проводилась. Таким образом, мы не смогли определить долю субъектов, затронутых каждым из этих возможных основных механизмов, или определить основной механизм, лежащий в основе сосуществования HBsAg и анти-HBs.

Согласно нашим результатам, сосуществование HBsAg и анти-HBs было связано с развитием ГЦК.Этот результат согласуется с результатами предыдущего небольшого исследования со средним периодом наблюдения 4,3 года, в котором сообщалось о 2-кратном увеличении частоты случаев ГЦК в группе сосуществования, чем в группе с положительным результатом только HBsAg 13 . Наше исследование с участием 2341 пациента с примерно 5-летним наблюдением показало аналогичные результаты, сообщая о 3,1-кратном более высоком риске ГЦК в группе сосуществования, чем в контрольной группе, независимо от других факторов риска ГЦК. Поскольку делеция областей пре-S1, один из возможных механизмов двойного положительного результата по HBsAg и анти-HBs, была предложена как фактор риска прогрессирующего заболевания печени, включая гепатоканцерогенез 15,29,30 , это может объяснить увеличение Возникновение ГЦК в группе сосуществования.Дальнейшее исследование по оценке мутационного статуса pre-S1 в группе сосуществования и контрольной группе может помочь оценить, может ли этот феномен объяснить повышенную заболеваемость ГЦК в группе сосуществования.

Интересно, что сосуществование HBsAg и анти-HBs также было связано с увеличением сероочистки HBsAg, что связано с хорошим прогнозом 25,31,32 . Одно правдоподобное объяснение большего количества серологически чистых HBsAg состоит в том, что пациенты, у которых после сероконверсии были анти-HBs, а затем наблюдалась временная низкоуровневая серореверсия HBsAg, были включены в группу сосуществования, как указано выше.Поскольку эти пациенты обычно имеют очень низкие уровни HBsAg и, как правило, испытывают повторное серологическое разрешение HBsAg 25,27 , это может объяснить лучшее серологическое разрешение HBsAg в группе сосуществования, чем в контрольной группе. Другое правдоподобное объяснение состоит в том, что сероочистка HBsAg не является показателем вирусного клиренса, а скорее является точечной мутацией в гене S, которая приводит к невозможности обнаружения HBsAg 33,34 . В этом исследовании только 10% субъектов (4 из 39 пациентов) с серологическим разрешением HBsAg в группе сосуществования были подвергнуты анализу уровня ДНК HBV во время серологического разрешения, и эти 4 пациента показали отсутствие или минимальный уровень ДНК HBV (меньше чем 20 МЕ / мл), что указывает на истинную серологическую очистку HBsAg с вирусным клиренсом, а не на неудачу обнаружения.

Сосуществование HBsAg и анти-HBs было связано с риском возникновения ГЦК, что свидетельствует о плохом исходе. Однако сосуществование HBsAg и анти-HBs также было связано с сероклинированием HBsAg, что представляет собой благоприятный результат. Кроме того, эти события были взаимоисключающими. Другими словами, в группе сосуществования у 6 пациентов развился ГЦК, и 39 пациентов испытали сероклинирование HBsAg во время наблюдения. Однако ни у одного пациента не было одновременного исчезновения HBsAg и возникновения ГЦК.Этот результат предполагает, что группа сосуществования неоднородна. Более подробные серологические анализы, включая вирусные мутации, могут помочь выявить различия в этих популяциях.

Это исследование имеет несколько сильных сторон. Во-первых, это исследование является первым, в котором оцениваются долгосрочные результаты у пациентов с двойным положительным результатом на HBsAg / анти-HBs по нескольким аспектам, включая возникновение ГЦК, серологическое разрешение HBsAg и общую смертность. Во-вторых, HBsAg оценивался почти ежегодно у большинства пациентов со средним значением 4.4 раза на пациента в течение 5-летнего периода наблюдения. Поскольку уровень HBsAg и анти-HBs варьируется, изменение уровней HBsAg и анти-HBs можно оценить с помощью этого регулярного повторного наблюдения.

Это исследование имеет несколько ограничений. Во-первых, хотя в этом исследовании описаны долгосрочные исходы пациентов, положительных как на HBsAg, так и на анти-HBs, основной механизм не был определен в этом исследовании, как упоминалось выше. Необходимы дальнейшие исследования, такие как оценка мутаций пре-S1, для оценки механизма, лежащего в основе более высокой частоты ГЦК или большей сероочистки HBsAg в группе сосуществования, чем в контрольной группе.Во-вторых, достаточный серологический профиль, отражающий статус инфекции HBV, такой как HBeAg, анти-HBe и ДНК HBV, не был оценен у всех субъектов из-за характера нашей политики скрининга здоровья. В-третьих, в это исследование были включены только корейские пациенты одного этнического происхождения, более 99% которых были инфицированы генотипом C HBV 35 . Чтобы обобщить эти результаты, может потребоваться проверка в других этнических группах с различными генотипами.

В заключение, это исследование показывает отдаленные результаты у пациентов, положительных как на HBsAg, так и на анти-HBs.Сосуществование HBsAg и анти-HBs было связано с более высокими показателями заболеваемости ГЦК и большей серологичностью HBsAg, чем присутствие только HBsAg. Тем не менее, общая смертность существенно не различалась между группой сосуществования и контрольной группой. Это предполагает, что группа сосуществования не может быть определена как одна однородная группа, а состоит из групп с благоприятными исходами и групп с неблагоприятными исходами.

Этическое одобрение и информированное согласие

Этот протокол исследования соответствовал этическим принципам Хельсинкской декларации 1975 г. и был одобрен Наблюдательным советом больницы Сеульского национального университета (H-1704-078-846).Требование информированного согласия субъектов было отменено, потому что исследователи получали доступ только к деидентифицированным записям в базе данных для аналитических целей.

Грантовая поддержка

Это исследование было поддержано грантом 04-2017-0730 (2017–1131), предоставленным Исследовательским фондом больниц Сеульского национального университета. Финансирующие организации не играли никакой роли в разработке или проведении исследования, сборе, анализе или интерпретации данных, а также в написании, рецензировании или утверждении рукописи.

HBsAg — обзор | ScienceDirect Topics

Диагностика острого и хронического гепатита B

HBsAg — это первый серологический маркер, который появляется и может быть обнаружен в течение 1-2 недель после заражения. Он предшествует развитию симптомов в среднем на 4 недели. 104 Наличие HBsAg указывает на продолжающуюся инфекцию. В большинстве клинических лабораторий используются качественные, а не количественные методы, поскольку количество антигена не коррелирует с активностью заболевания или наличием острой или хронической инфекции. 26 Некоторые пациенты с симптомами могут иметь самостоятельно купирующуюся острую инфекцию HBV без детектируемого HBsAg. У этих пациентов, до 9% в некоторых исследованиях, есть другие обнаруживаемые маркеры инфекции. 104 HBeAg появляется практически одновременно, достигает пика, а затем снижается параллельно с HBsAg. Обычно он исчезает раньше, чем HBsAg. Взрослые пациенты, которые остаются устойчиво положительными на HBeAg в течение более 10 недель, могут стать хронически инфицированными. HBeAg указывает на высокий уровень вирусной репликации и инфекционности.У большинства пациентов с неопределяемым HBeAg наблюдается разрешающееся, минимальное или полное отсутствие активного заболевания печени. 26 Предварительные мутанты HBV не экспрессируют HBeAg; они могут быть причиной более тяжелого течения и, в некоторых случаях, молниеносной болезни. Уровни аминотрансферазы в сыворотке повышаются, но неспецифичны. Они начинают увеличиваться непосредственно перед развитием симптомов, а затем достигают пика (иногда в 20 или более раз выше нормы) с развитием желтухи.

Диагноз хронической инфекции HBV основывается на сохранении соответствующих маркеров в течение как минимум 6 месяцев или на обнаружении этих маркеров у ребенка, у которого при первичном обращении имеются исторические или физические доказательства давней инфекции.Эта информация обобщена на рисунках 75-3 и 75-5 и в таблицах 75-4 и 75-6.

Третий маркер инфекции — ДНК HBV, которая появляется вместе с HBsAg, достигает пика с появлением симптомов, а затем снижается. Анти-HBc — это последний серологический маркер, который появится. Обычно его можно обнаружить через 3-5 недель после появления HBsAg, но до появления симптомов, и он сохраняется на всю жизнь. Наличие анти-HBc указывает на текущую или перенесенную инфекцию. Anti-HBc не появляется после вакцинации против HBV и, следовательно, в присутствии anti-HBs помогает отличить иммунитет, вызванный вакцинацией, от иммунитета, вызванного естественной инфекцией.

Anti-HBs указывает на излечившуюся или перенесенную инфекцию или успешную иммунизацию вакциной и обеспечивает защитный иммунитет. У большинства пациентов с самоограничивающейся инфекцией он может быть обнаружен только после того, как HBsAg становится неопределяемым. У меньшинства пациентов с симптомами, похожими на сывороточную болезнь, анти-HBs могут появиться до появления клинических симптомов. 105,106 У некоторых пациентов описано «окно» переменной продолжительности, в течение которого HBsAg исчезает, а анти-HBs еще не обнаруживаются. 104 В этих случаях может оказаться полезным определение анти-HBc.

Антитело к HBeAg (anti-HBe) появляется после того, как HBeAg становится неопределяемым, и сохраняется в течение 1-2 лет после разрешения гепатита. Маркеры HBV и их интерпретация обобщены в Таблице 75-4.

Иммунизация против гепатита B и постиммунизационная серология

Иммунизация против гепатита B и постиммунизационная серология

Майкл Джон , МБ, гл.Б., FRCP (C) •

J Can Dent Assoc 2000; 66: 551-2


До введения
вакцина против вируса гепатита B (HBV) представляла серьезный профессиональный риск для медицинских работников.
Некоторые из самых высоких показателей инфицирования были обнаружены у стоматологов и хирургов. 1
Риск развития хронического гепатита B у инфицированных медицинских работников составляет 5-10%.
о кластерах передачи ВГВ от стоматолога пациенту сообщалось на протяжении многих лет,
хотя с момента введения универсальных мер предосторожности их количество уменьшилось. 2
Недавние руководящие принципы Министерства здравоохранения Канады рекомендуют ограничение практики оказания медицинской помощи.
работники с положительным результатом теста на антиген гепатита B. 3

Разработка вакцин против гепатита в 1980-х годах значительно снизила количество стоматологических
риск заражения ВГВ у рабочих. Недавний опрос 4 стоматологов в Канаде
показали, что более 90% прошли серию иммунизации, а еще 3% имели
естественный иммунитет. Однако показатели иммунизации среди ассистентов стоматолога и гигиенистов
оказалось намного ниже.

Вакцины против гепатита В

Поверхностный антиген гепатита B (HBsAg) индуцирует нейтрализующие антитела (anti-HBs)
которые защищают от инфекции HBV. Первоначальная вакцина против гепатита B Heptavax была получена
из плазмы человека, и, хотя и необоснованные, опасения по поводу возможного заражения
другие патогены, передающиеся с кровью, препятствовали его широкому распространению. Два генно-инженерных
вакцины, полученные путем встраивания гена HBsAg в дрожжи Saccharomyces и
сбор произведенного HBsAg доступен в Канаде.Engerix B и Recombivax являются
эквивалент и могут использоваться как взаимозаменяемые. Рекомендуемый график дозирования равен нулю,
один и 6 месяцев; однако возможны ускоренные схемы (ноль, один и 2 месяца, с
бустерная доза вакцины в 12 месяцев 5 ).

Вакцина вводится внутримышечно в дельтовидную мышцу, как ягодичную.
инъекция может привести к снижению скорости ответа. Ответ на вакцину после введения 3 доз
у молодых, здоровых людей, как правило, превышает 95%, хотя с возрастом
возраст (<90% ответа в возрасте 40 лет и только 75% ответа в возрасте 60 лет).Другие факторы, такие как курение, ожирение и хронические заболевания снижают эффективность вакцины и могут использоваться для прогнозирования риск неполучения ответа. 6 Побочные эффекты минимальны, хотя легкие в месте инъекции
реакции могут возникнуть у 20% реципиентов.

Уровни антител, необходимые для защиты

Уровни анти-HBs выше 10 мМЕ / мл обеспечивают практически полную защиту от
HBV. 7 Обычно уровни в 100 или 1000 мМЕ / мл достигаются после
серия из 3 доз, и некоторые авторитетные источники рекомендуют четвертую дозу, если уровни составляют 10–100 мМЕ / мл.Людям, которые не ответили на начальную серию, могут быть введены дополнительные дозы. О
15-25% людей ответят на одну дополнительную дозу, а 30-50% ответят на 3 дополнительных
дозы. 6 По некоторым данным, внутрикожная вакцина, вводимая в полных дозах,
может вызвать сероконверсию у постоянно не отвечающих на вопросы. 8 Люди, которые не
ответят после 2 серий, следует предупредить, что они могут быть восприимчивы к ВГВ и должны
получить иммунный глобулин гепатита B (HBIG) после контакта с HBV.

Постиммунизационное тестирование на иммунитет

Хотя медицинские работники, выполняющие инвазивные процедуры, обязаны
Чтобы узнать их серостатус, тестирование на анти-HBs после вакцинации было спорным. В
опрос канадских стоматологов, только 72% сообщили, что знают свой серостатус после
иммунизация. 4 Утверждалось, что высокий уровень сероконверсии
большинство реципиентов и снижение профессионального риска заражения вирусом гепатита В делают это ненужным.Другие
предположили, что тестирование после контакта и введение HBIG лицам, не отвечающим на лечение, являются
более рентабельно, чем тестирование после иммунизации. 6 Этот аргумент основан на
высокие показатели сероконверсии, наблюдаемые при использовании вакцины, и относительно низкий риск
экспозиция. Тем не менее, это предполагает, что люди, подвергшиеся воздействию ВГВ, последуют за
протокол после контакта. Многие могут не знать, потому что они не знают, что пациент
переносчика вируса или потому, что они чувствуют себя защищенными, поскольку они были иммунизированы.Адекватное ведение после контакта также требует знания иммунного статуса для определения
следует ли вводить HBIG. Антитела, индуцированные вакциной, со временем снижаются, и выше
до 60% из тех, кто первоначально отвечает на вакцинацию, теряют антитела в течение 12 лет. 9
Следовательно, эти люди могут получать HBIG без необходимости.

Нужны ли бустерные дозы вакцины против гепатита В?

Когда были выпущены рекомбинантные вакцины, первоначальные рекомендации включали:
бустерные дозы вакцины через 5 лет из-за снижения уровня антител.Однако исследования
показали, что даже если уровни анти-HBs падают ниже 10 мМЕ / мл и происходит инфицирование, это
преходящее и клинически незаметное и хроническое заболевание не развивается. Таким образом
Национальный консультативный комитет по иммунизации больше не рекомендует бустерные дозы в
иммунокомпетентные люди или периодические тесты для определения уровня антител. 10

Заключение

Все стоматологические работники, не имеющие иммунитета, должны пройти иммунизацию
рекомбинантная вакцина против гепатита В.После иммунизации необходимо провести серологическое исследование, чтобы убедиться, что
сероконверсии и направлять дальнейшую иммунизацию и постконтактную профилактику. Следующий
сероконверсия, бустерные дозы вакцины не требуются.


Доктор Джон — заведующий отделением инфекционного контроля Лондонского центра медицинских наук.
и St. Joseph’s Health Care, Лондон, Онтарио.

Для корреспонденции: Д-р Майкл Джон, микробиология и иммунология, Лондонское здравоохранение
Центр наук, кампус Виктория, Вестминстерский участок, 800 Commissioners Road E., Лондон ON
N6A 4G5. Электронная почта: [email protected]

Выраженные взгляды принадлежат автору и не обязательно отражают мнение
или официальная политика Канадской стоматологической ассоциации.


Список литературы

1. Томас Д.Л., Грунингер С.Е., Сью К., Джой Э.Д., Куинн Т.С. Профессиональный риск
инфекции гепатита С среди стоматологов общей практики и хирургов-стоматологов в Северной Америке. Am J
Med
1996; 100: 41-5.

2. Фредекинд Р. Э., Куни Э. Дж., Пельтье Б., Карпентер В. М.. Положительный по е-антигену гепатита В
абитуриент стоматологической школы. J Dent Educ 1999; 63: 766-71.

3. Медицинская лаборатория по контролю заболеваний. Труды консенсусной конференции по
инфицированные медицинские работники: риск передачи патогенов, передающихся с кровью. Может общаться
Dis Rep
1998; 24Поставка 4. http://www.hc-sc.gc.ca/hpb/lcdc/publicat/ccdr/98vol24/24s4/index.html

4.Маккарти GM, Коваль JJ, Макдональд JK. Производственные травмы и облучения среди
Канадские стоматологи: результаты национального исследования. Infect Control Hosp Epidemiol
1999; 20: 331-6.

5. Джилг В., Шмидт М., Дейнхардт Ф. Вакцинация против гепатита В: сравнение трех
разные графики вакцинации. J Infect Dis 1989; 160: 766-9.

6. Алимонос К., Нафцигер А.Н., Мюррей Дж., Бертино Дж. С. Младший. Предсказания реакции на
вакцина против гепатита B у медицинских работников: чьи титры антител к гепатиту B
поверхностный антиген следует определять после серии из трех доз, и каковы
последствия с точки зрения рентабельности? Clin Infect Dis 1998; 26: 566-71

7.Джек А.Д., Холл А.Дж., Мэн Н., Менди М., Уиттл ХК. Какой уровень антител к гепатиту В
защитный? J Infect Dis 1999; 179: 489-92.

8. Propst T, Propst A, Lhotta K, Vogel K, Konig P. Усиленный внутрикожный гепатит B
вакцинация у пациентов, находящихся на гемодиализе, превосходит антительный ответ на внутримышечные или
подкожная вакцинация. Am J Kidney Dis 1998; 32: 1041-5.

9. Иммунизация медицинских работников: рекомендации Консультативного комитета по
Практика иммунизации (ACIP) и Консультативная практика больничного инфекционного контроля
Комитет. MMWR Morb Mortal Wkly Rep 1997; 46 (RR-18): 1-42.

10. Холтон Д. Пересмотренное руководство по ревакцинации против гепатита B. Can
Med Assoc J
1992; 147: 1029-32.


HBs — Что означает ANTI-HBs? Бесплатный словарь

Результаты по HBsAg, анти-HBs, анти-ВИЧ и анти-HCV оценивались отдельно для каждого года (таблица 2, рисунок 1). 5).Этим домашним контактам было предложено пройти тестирование на ВГВ, а те, чей результат теста был положительным на HBsAG, были подключены к медицинской помощи; успокаивались лица, результаты теста которых были HBsAG-отрицательными с положительными результатами анти-HBs (свидетельствующими об иммунитете через иммунизацию или разрешенную инфекцию); а лицам, чьи результаты анализов были отрицательными по всем трем серомаркерам HBV (восприимчивым к инфекции), была предложена вакцинация против гепатита B (серия из 3 доз в течение 6 месяцев). Все положительные образцы анти-HBc были протестированы на наличие поверхностных антител против гепатита B. набор anti-HBs (Bio-Rad, Марн-ла-Кокетт, Франция).Ежегодное наблюдение за уровнем анти-HBs проводилось, ревакцинация вакциной против гепатита В 40 мкг внутримышечно вводилась ежегодно в течение до трех лет, если уровни анти-HBs соответствовали демографическим характеристикам; оценка Восточной совместной онкологической группы (ECOG) до лечения; Постановка Анн-Арбора; гистология; количество циклов ритуксимаба; сывороточные уровни анти-HBc, анти-HBs и ДНК HBV; и сывороточные уровни аланинаминотрансферазы (ALT), аспартатаминотрансферазы (AST), общего билирубина (TB), лактатдегидрогеназы (LDH) и альбумина и изменения были зарегистрированы для каждого из 98 HBsAg-отрицательных пациентов.Sobre a situacao imunologica, apesar de os niveis de anti-HBs nao terem sido medidos entre os membersantes, для возможного исследования resposta acerca da realizacao do exame sorologico (anti-HBs) apos vacinacao.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

© 2021 КОПИИ БРЕНДОВЫХ ЧАСОВ
Область S No.остаточных изменений / 100 а.о. ( P )


Все пациенты ( n = 26) a Группа I ( n = 14) Группа II ( n = 12) b
Полноразмерный участок S-белка (а.о. 1-226) 3,22 (0,040) 4,55 1,66 (0,009)
N-концевой участок S-белка (ак 1-99) 2,64 (1) 4.12 0,93 (0,008)
Антигенные петли MHR (а.о. 100-169) 3,74 (0,046) 5,71 1,43 (0,004)
«а» детерминанта (аа 124-147)

6,25 (0,001) 9,52 5,23 (0,009)
С-концевой участок S-белка (аминокислотные остатки 170-226) 3,58 (0,194) 3,88 3,22 (0,570)