Генотип 1: HCV, генотипирование (типы 1a, 1b, 2, 3a, 4), РНК [реал-тайм ПЦР]

Содержание

Генотипирование и количественное определение РНК гепатита С

Генопирование  вируса гепатита С

 

Вирус гепатита С отличается высокой изменчивостью — способностью к мутациям (изменениям в генетическом строении). Способность к изменению позволяют вирусу ускользать от иммунной системы и затрудняет лечение гепатита С. В действительности, вирус гепатита С — это целый спектр подобных вирусов, которые можно выделить в отдельные подгруппы, которые классифицируют по генотипам и субтипам.

Насчитывают 11 генотипов ВГС, однако в России распространены 3 основных генотипа — 1, 2 и 3, поэтому большинство диагностических центров определяют генотипы (генотипируют) 1, 2 и 3.

Генотипирование (определение генотипа вируса) — один из самых важных анализов. Он позволит предсказать  шансы на успешное лечение и поможет врачу определить необходимые дозы препаратов и длительность  терапии.

Зачем нужно определять генотип? 

Это очень важный анализ. Разные генотипы имеют различную резистентность (устойчивость) к лечению. Так, например, генотипы 2 и 3 лечатся стандартной терапией в течение 24 недель с эффективностью до 85%, а генотип 1 и 4 — 48 недель с эффективностью до 60%.

Имеет ли значение субтип генотипа, например 1a? 

Нет, клинического значения субтип не имеет. Главное·— определить цифру (сам генотип).

Что значит, если в результатах генотипирования стоит

«генотип не типируется»?   

Это может быть по двум причинам — у Вас не типичный для нашего региона, «экзотический» генотип HCV или низкая концентрация вирусной РНК в крови.

Может ли генотип измениться с течением времени? 

Нет, для этого требуется тысячи лет. У некоторых пациентов имеется 2 и более генотипов, но преобладает один. В таком случае анализом может обнаружиться только один генотип. Бывают случаи, когда у пациентов определяли, к примеру, генотип 3a, а после лечения выявляли генотип 1b. Причиной тому было одновременное присутствие генотипов 3 и 1b. От первого типа удалось избавиться в результате терапии, а второй из-за устойчивости к препаратам оставался в организме.

Количественное определение РНК  гепатита С

Почему важно делать количественное определение  РНК вируса гепатита С?

Количественная характеристика содержания РНК вируса гепатита С в клинических образцах важна для оценки эффективности противовирусной терапии и имеет прогностическое значение для определения хронизации этого гепатита. Если концентрация вируса меньше 8х105 МЕ/мл (2х106 копий/мл), то прогноз курса лечения благоприятный, если выше — то рекомендуют использовать другие схемы лечения. Вирусная нагрузка ниже 8х105 МЕ/мл (2х106 копий/мл) наряду с определением генотипа вируса является независимым и самым точным параметром эффективности лечения. Снижение концентрации РНК вируса гепатита С к третьему дню от начала терапии на 85% является быстрым и точным параметром для предсказания эффективности терапии, приводящей к раннему вирусологическому ответу.

Показания к назначению анализа:

Положительный качественный тест на наличие РНК вируса гепатита С в сыворотке крови.

Определение тактики лечения пациентов.

Точная оценка эффективности лечения.

Консультативно-диагностическая поликлиника НПО «ВИРИОН» предлагает широкий спектр современной лабораторной диагностики гепатита С и других заболеваний печени. 

< Предыдущая   Следующая >

Генотипирование вируса гепатита С (1a. 1b, 2a, 2b, 3a)

Генотипирование вируса гепатита С (1a. 1b, 2a, 2b, 3a)

Генотипирование вируса гепатита С (1a. 1b, 2a, 2b, 3a) — Определение генотипа вируса гепатита С ПЦРанализом имеет большое значение для выбора тактики лечения и прогноза течения заболевания. На сегодняшний день известно 6 генотипов и более 100 субтипов вируса гепатита С. Для клинической практики достаточно разграничивать пять субтипов вирусного гепатита С: 1а, 1b, 2а, 2b, 3а. Вирус гепатита С отличается высокой изменчивостью — способностью к мутациям (изменениям в генетическом строении). Способность к изменению позволяет вирусу ускользать от иммунной системы и затрудняет лечение гепатита С. В действительности, вирус гепатита С — это целый спектр подобных вирусов, которые можно выделить в отдельные подгруппы, которые классифицируют по генотипам и субтипам. Гепатит С генотипа 1, в частности — 1b,  является самым распространенным в странах бывшего СССР. Этот генотип труднее остальных поддается лечению. Разные генотипы имеют различную резистентность (устойчивость) к лечению. Так, например, генотипы 2 и 3 лечатся стандартной терапией в течение 24 недель с эффективностью до 85%, а генотип 1 и 4 — 48 недель с эффективностью до 60%. Также есть данные, что у пациентов с генотипом 3 чаще обнаруживается сопутствующее заболевание печени — стеатоз.

Подготовка к исследованию

Специальной подготовки не требуется.

Забор крови необходимо производить спустя 10-14 дней после прекращения приема химиопрепаратов и лечебных процедур.

Показания к исследованию

Для выбора курса лечения и оценки эффективности лечения.

Оценка перехода инфекции в хроническую стадию.

Интерпретация

1. Обнаружена РНК вируса гепатита С, с указанием субтипа– выдается в случае обнаружения у пациента присутствия РНК ВГС и возможности ее типирования.

2. Обнаружена РНК вируса гепатита С – выдается в случае обнаружения у пациента присутствия РНК ВГС, которую нельзя отнести к генотипам 1, 2 или 3.

3. Не обнаружено – РНК вируса гепатита С не выявлена или концентрация возбудителя ниже предела чувствительности метода.

Генотип вируса является достоверным фактором, влияющим на характер течения инфекции вируса гепатита С, частоту хронизации, вероятность ответа на противовирусную терапию. Знание генотипа вируса используется для планирования продолжительности курса лечения, что особенно важно, учитывая широкий спектр побочных действий применяемых препаратов интерферона и плохую переносимость терапии многими пациентами.

На результаты могут влиять

Факторы, вызывающие ложноположительный результат: контаминация (загрязнение) пробы при транспортировке и непосредственно в лаборатории.

Факторы, вызывающие ложноотрицательный результат: неправильный забор материала для исследования.

Генотипирование вируса гепатита C должно выполняться всем пациентам до начала противовирусной терапии в целях планирования ее продолжительности, прогнозирования эффективности, в отдельных случаях – для расчета дозы противовирусных препаратов.

Назначается в комплексе с

1.HCV (ПЦР качественный) 

2.HCV (ПЦР количественный) 

гепатита C | Университетская клиника г. Фрайбурга

До сих пор диагноз «хронический гепатит С» для многих пациентов означал длительный и утомительный курс лечения с незначительными шансами на выздоровление. К счастью, скоро такой сценарий останется в прошлом: с помощью целого ряда революционных, практически свободных от побочных действий медикаментов, почти все пациенты могут быть излечены. Медики Университетской клиники г. Фрайбурга не только успешно применяют новый метод, но и сами активно участвовали в исследовании и допуске этих революционных препаратов к использованию.

Вирус гепатита С вызывает хроническое воспаление печени, зачастую приводящее к циррозу или раку печени. В отличие от гепатита А и В, против гепатита С на сегодняшний день не существует вакцины. Стандартным методом лечения до сих пор являлась терапия препаратами интерферона альфа и рибавирина, продолжавшаяся целый год и приносившая излечение лишь от 40 до 80 процентов инфицированных пациентов.

Теперь новые медикаменты пришли на смену интерферону: так называемые антивирусные препараты прямого действия (англ. Directly Acting Antivirals (DAA)). Они целенаправленно противодействуют размножению вируса. Фрайбургский Центр лечения печени активно принимал участие во многих исследованиях и испытаниях, а также в процессе допуска новых медикаментов. Наряду с тем, что почти все пациенты хорошо переносят новые препараты, теперь и те больные, которые до этого по разным причинам не были допущены к терапии, могут лечиться новыми препаратами. Так как инфекция десятилетиями может протекать без симптоматики, её часто обнаруживают, когда печени уже нанесен ущерб. Пациенты с высокой степенью поражения печени ранее не подлежали лечению. Поскольку интерферон наряду с похожей на грипп симптоматикой может вызывать и изменения психического характера, пациенты с депрессией в анамнезе не допускались к терапии, а тяжесть побочных действий зачастую приводила к прерыванию лечения.

Совсем иную картину мы видим при использовании новых препаратов DAA. Начиная с 2015 года, появилась возможность полностью избавиться от этого заболевания без применения интерферона. Процесс лечения теперь занимает лишь несколько месяцев.  Новый вид терапии состоит в приеме новых лекарственных препаратов в виде таблеток на протяжении 8-12 недель. В 90% случаев происходит полное излечение от вируса. В период лечения могут наблюдаться лишь слабые побочные эффекты, такие как усталость, головная боль, легкая тошнота.

На сегодняшний день уже более 300 пациентов с диагнозом «хронический гепатит С» прошли безинтерфероновую терапию в отделении гастроэнтерологии, гепатологии, эндокринологии и инфектологии Университетской клиники г. Фрайбурга. После завершения курса терапии у 97% пациентов вирус гепатита С был полностью выведен из организма. Для лечения наиболее распространённой формы вируса гепатита С –генотипа 1 – сегодня применяется два режима безинтерфероновой терапии. Это препараты софосбувир (Sofosbuvir) и ледипасвир ( Ledipasvir), которые сочетаются в одной таблетке под названием харвони (Harvoni®). Таблетку принимают один раз в день. Курс терапии длится 8 недель при благоприятном прогнозе (при низкой вирусной нагрузке у пациента, при условии отсутствия у него цирроза печени, а также при условии, что пациент не подвергался терапии противовирусными препаратами. Во всех остальных случаях длительность лечения составляет12 недель. Пациентам, страдающим циррозом печени, требуется более продолжительная противовирусная терапия, и при этом им необходимо, наряду с вышеперечисленными лекарствами, дополнительно принимать рибавирин.

У пациентов с гепатитом генотипа 1b имеется возможность приема альтернативных лекарственных средств на протяжении более 12 недель, таких как омбитасвир, паритапревир и дасабувир. Затем необходимо принимать утром 2 таблетки викиракса (Viekirax®) и по одной таблетке эксвиеры (Exviera®) вечером и утром.

Курс лечения часто встречающегося вирусного гепатита С генотипа 3, как правило, осуществляется с помощью приема препаратов софосбувира (совальди) и даклатасвира (даклинзы), в сочетании друг с другом, и также имеет продолжительность более 12 недель. У пациентов с циррозом печени курс лечения продолжается дольше. Начиная с осени 2016 года, наше отделение сможет предложить лечение генотипа 3 с помощью одной таблетки в день. В ходе клинических испытаний 12-недельный прием комбинации из препаратов софосбувира и велпатасвира в одной таблетке показал полное выздоровление в 95% случаев.

Научные сотрудники Клиники гастроэнтерологии, гепатологии, эндокринологии и инфектологии Университетской клиники г. Фрайбурга, которой руководит профессор, д.м.н. Роберт Тимме, дают объяснение эффективности новых медикаментов. Они исследовали роль определенной группы T-клеток, т. е. иммунных клеток тела. „Обычно они участвуют в устранении вирусов. Однако вирус гепатита С очевидно целенаправленно подавляет именно эту группу Т-клеток“, — объясняет д-р Нойманн-Хефелин. «Интерфероновая терапия наносит им дополнительный вред. Интерфероны лишь имитируют иммунный ответ, настоящая же иммунная система при этом не способна помочь в устранении вируса».

Ученые установили, что новый вид терапии с препаратами группы DAA наоборот даже усиливает действие T-клеток. В дополнение к тому, что DAA непосредственно атакуют вирус, они еще оказывают поддержку иммунной системе собственного организма. 20 лет назад диагноз «гепатит С» вызывал у пациентов ужас, сегодня это заболевание, которое может быть излечено эффективно и в краткие сроки.

Новейшие способы диагностики позволяют в кратчайшие сроки выявить генотипы гепатита С, количество вирусов в крови и с помощью эластометрии  (Fibroscan®) исследовать ткань печени и определить степень заболевания. Задача врачей заключается в разъяснении пациентам вопроса о необходимости и срочности лечения, а также в подборе оптимальных режимов терапии. Наш большой опыт  безинтерферонового лечения гепатита С доказывает высокую эффективность данного метода на основе хорошего вирусологического ответа почти у всех пациентов.

ГЕПАТИТ С

Вирус передается парентеральным путем, прежде всего через кровь. В этой связи опасность представляют внутривенное употребление наркотиков, нестерильные инструменты при нанесении татуировок и пирсинга и зараженные шприцы. До тех пор, пока вирус в середине 90-х годов не был выявлен, существовала вероятность заражения в результате переливания крови.

RNA HCV (генотип)


Молекулярно-генетическое исследование для определения генотипа вируса гепатита Св  крови методом полимеразной цепной реакции (ПЦР) с детекцией в режиме реального времени. Чувствительность метода составляет 1000 копий/мл (или 400 МЕ/мл). Применяемый набор реагентов может быть использован для диагностики вируса гепатита С и наиболее распространённых на территории России генотипов HCV (1a, 1b, 2 и 3a/3b) in vitro.


Возбудитель гепатита С представляет собой небольшой, покрытый оболочкой вирус. Геном представлен одноцепочечной РНК, которая кодирует 3 структурных и 5 неструктурных белков.ВГС обладает наибольшей вариабельностью среди всех возбудителей вирусных гепатитов и благодаря высокой мутационной активности способен избегать воздействия защитных механизмов иммунной системы. Геномы вируса значительно отличаются в разных странах мира и имеют различную чувствительность к препаратам интерферонов.Существует 6 основных генотипов вируса гепатита С и около 500 субтипов. Наиболее распространён в мире генотип 1 (40-80 %). 1а тип часто выявляется в США, 1b характерен для Западной Европы и Южной Азии. Генотип 2 встречается с частотой 10-40 %. Генотип 3 распространён в Шотландии, Австралии, Индии и Пакистане. ВГС 4 типа характерен для Средней Азии и Северной Африки, генотип 5 – для Южной Африки, 6 – для некоторых стран Азии. В России преобладает генотип 1b, далее с убывающей частотой — 3, 1a, 2, в США – 1a/1b, 2b, и 3a.


Генотипирование РНК вируса гепатита С позволяет спрогнозировать эффект от планируемой терапии. Генотип 1 хуже поддаётся лечению, чем генотипы 2 и 3. Повышенные дозы препаратов интерферона рекомендованы для пациентов с 1-м и 4-м генотипами. Курс терапии у таких пациентов должен быть продлён до 48 недель даже при отсутствии вируса в крови более 24 недель. В случае успешности лечения, которая подтверждается снижением вирусной нагрузки крови вероятен более короткий срок терапии. Генотипы 2 и 3 хорошо поддаются терапии в 80 % случаев, обычно это занимает 24 недели.


Согласно рекомендациям Минздрава РФ от 3 сентября 2014 года, генотипирование вируса гепатита C должно выполняться всем пациентам до начала противовирусной терапии в целях планирования ее продолжительности, прогнозирования эффективности, в отдельных случаях – для расчета дозы противовирусных препаратов. 


Кровь рекомендуется сдавать не ранее чем через 4 часа после последнего приема пищи (воду пить можно).


Материал для исследования: сыворотка крови.


Интерпретация результатов содержит аналитическую информацию для лечащего врача. Лабораторные данные входят в комплекс всестороннего обследования пациента, проводимого врачом и не могут быть использованы для самодиагностики и самолечения.


 


При обнаружении РНК вируса гепатита С проводится ее типирование и в результате  указывается типа вируса.


Решение о длительности терапии, необходимой дозе препаратов и прекращении лечения может принять только лечащий врач на основании биохимических анализов функции печени, биопсии (при необходимости) и вирусной нагрузки. Существует вероятность повторного заражения вирусным гепатитом С другого генотипа из-за отсутствия перекрёстного иммунного ответа и стойкого иммунитета.

Вирус гепатита С: генотипирование по генотипам 1-6 (ВГС, определение генотипов 1-6, HCV Genotyping)

Исследуемый материал
Плазма крови (ЭДТА)

Метод определения
ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени.

Тест направлен на определение генотипа (1a, 1b, 2, 3а, 4, 5а, 6) вируса гепатита С (ВГС). Применим для генотипирования ВСГ у пациентов с вирусной нагрузкой выше 5000 МЕ/мл. Исследование не предназначено для скрининга ВГС.

Гепатит С – вирусное заболевание печени, которое часто переходит в хроническую форму (55-85% инфицированных). У части таких пациентов (15-30%) хронический гепатит в течение 20 лет может приводить к циррозу печени и повышению риска развития карциномы печени. Прогноз заболевания и эффективность разных вариантов противовирусной терапии в определенной степени зависят от генотипа вируса. 

В лечении гепатита С в настоящее время достигнут значительный прогресс, разработаны новые противовирусные препараты. Стандарты лечения пациентов с гепатитом С быстро меняются. Для выбора оптимального подхода к терапии, определения схемы и длительности лечения пациента рекомендуется провести некоторые дополнительные лабораторные исследования, прежде всего исследование для определения генотипа вируса. Согласно клиническим рекомендациям Минздрава РФ 2016 года, генотипирование вируса гепатита С должно выполняться всем пациентам при планируемой противовирусной терапии. 

Различают шесть основных генотипов (1, 2, 3, 4, 5, 6) и множественные субтипы, например, 1a, 1b и пр. вируса гепатита С. В Российской Федерации распространены (по убывающей частоте) генотипы 1, 3, 2. Среди подтипов чаще встречается 1b, чем 1a, что аналогично европейской популяции, а также 3a. Генотипы 4-6 практически не встречаются в популяции РФ.

 

Литература

  1. Клинические рекомендации. Хронический вирусный гепатит С (ХВГС) у взрослых, МЗ РФ. 2016:71. 

  2. European Association for the Study of the Liver. EASL Recommendations on Treatment of Hepatitis C 2018. Journal of hepatology. 2018:51. https://doi.org/10.1016/j.jhep.2018.03.026 

  3. Материалы фирмы-производителя реагентов.

Анализ крови на Вирус гепатита С (Hepatitis C Virus), расширенное определение генотипа (типы 1а, 1b, 2, 3a, 4, 5, 6)


Вирус гепатита С представлен 6 основными генотипами, некоторые из них имеют подтипы, например 1а, 1b. Наиболее часто встречается 1 тип. В зависимости от географического положения выделяют преобладающие в данной стране типы. Так, В России распространены генотипы 1, 3, 2 (в порядке убывания). Наиболее распространенные подтипы — 1в и 3а.


Вне зависимости от конкретного генотипа вирус гепатита С может вызывать достаточно серьезное заболевание, сопровождающее губительным влиянием на печень, кроветворную систему. Гепатит С относят к хроническим инфекционным (вирусным) заболеваниям. Передается инфекция несколькими путями, но основным является, конечно же, гематогенный путь, то есть заражение через кровь (иглы или иные инструменты с элементами инфицированной крови). Также выделяют половой путь передачи, но риск инфицирования повышается в таком случае при непосредственном контакте с кровью (ссадины, трещины, эрозии). Передать вирус гепатит С может и мать-носитель своему ребенку во время родов (что бывает достаточно редко) или во время ухода за ним. Стоит отметить, что вирус не попадает в грудное молоко, поэтому не следует опасаться лактации как пути передачи инфекции малышу.


Так как заболевание чаще всего протекает без выраженной клинической картины, пациенты не предъявляют жалоб и узнают о наличии вируса в организме случайно, инфекцию называют “ласковый убийца”. Действительно, вирус влияет на организм умело маскируясь, при этом в течение длительного времени человек может не замечать никаких изменений в себе и без необходимой лабораторной диагностики может узнать о наличии заболевания уже на поздних стадиях (выраженные изменения ткани печени). В зависимости от фазы болезни выделяют признаки, которые обращают на себя внимание: слабость, повышение температуры тела, тошнота, рвота, изменение цвета мочи, кожные высыпания, зуд при острой инфекции. При хроническом инфицировании вне обострения пациента могут волновать депрессия, слабость, снижение веса, раздражительность.


Учитывая, что заболеваемость гепатитом С каждым годом растет, единственным точным методом диагностики является лабораторная диагностика, например, исследование на выявление всех известных генотипов вируса С.


Определение генотипа вируса гепатита С (HCV) помогает определить прогноз заболевания и тактику противовирусного лечения. Существует 6 генотипов и большое число подтипов ВГС. В России распространены генотипы 1, 3, 2 (в порядке убывания). Наиболее распространенные подтипы — 1в и 3а. HCV генотипа 1 имеет самый неблагоприятный прогноз эффективности терапии. Определение генотипа HCV необходимо проводить всем больным вирусным гепатитом C до начала противовирусного лечения.

Данное исследование заказывается только с услугой

P028 Вирус гепатита С


(HCV), качественное определение РНК.

Обращаем внимание, что при выявлении 2 генотипа вируса гепатита С лаборатория проводит дополнительное исследование — определение рекомбинантного генотипа (RF1_2k/1b HCV). Данная информация окажет значительную помощь лечащему врачу в выборе определенной схемы и препаратов противовирусной терапии и будет способствовать более эффективному лечению хронического гепатита С.


В случае выявления генотипа 2 вируса гепатита С срок выполнения исследования может быть увеличен до 10 дней.



Крайне важно вовремя узнать о наличии того или иного генотипа вируса С в организме, сдать анализ на вирус гепатита С. От этого будет зависеть комплекс терапии. Так, противовирусной терапии хуже поддается генотип 1, и лучше 2 и 3. Для решения о длительности лечения врач будет ориентироваться на вирусную нагрузку. При своевременном полной терапии можно ожидать стадию ремиссии без наличия осложнений со стороны органов и тканей. Конечно, в первую очередь во внимание принимаются изменения со стороны печени. На оценке ее состояния также основываются дополнительные методы диагностики активности гепатита.

Показания для проведения исследования:

· В случаях обнаружения вируса гепатита С при помощи иных анализов — выявление РНК качественно, обнаружении антител к вирусу гепатита С. В таких случаях исследования помогает лечащему врачу прогнозировать развитие заболевания, выбрать полный комплекс терапии, решить вопрос о необходимости биопсии печени.

Следует обратить внимание, что при минимальной вирусной нагрузке в ряде случаев исследование может быть затруднено, а результат ложнотрицательным.

Что нужно знать о вирусном гепатите С?

У меня гепатит С

Что нужно знать о вирусном гепатите С?

Информация подготовлена и любезно предоставлена Доктором Ларисой Юрьевной Бредневой. Содержит обновления 2011 года.

Информация предназначена для образовательных целей. Она не может быть использована в качестве замены консультации врача.

Что такое вирусный гепатит С?

Вирусный гепатит С (ВГС) это – инфекционное заболевание, которое возникает в результате инфицирования вирусом гепатита, и приводит к повреждению клеток печени различной степени тяжести. Вирусный гепатит С может быть острым и хроническим.

Как можно заразиться вирусным гепатитом С?

Вирус гепатита С передается при прямом контакте с человеческой кровью. Например, Вы можете инфицироваться, в случаях если:

  • Вы когда-либо употребляли наркотики, и при этом, пользовались общими шприцами или иглами.
  • Вам переливали кровь, компоненты крови или проводили пересадку органов от доноров с вирусом гепатита С.
  • Вы когда-либо находились на гемодиализе и могли иметь контакты с кровью находящейся на оборудовании.
  • Вы когда-либо работали в лечебных учреждениях и имели частые контакты с кровью на своей работе, особенно случайные уколы иглами.
  • У Вашей матери был диагностирован вирусный гепатит С.
  • Вы имели половой контакт с инфицированным вирусом гепатита С.
  • Вы жили с человеком инфицированным гепатитом С и пользовались его предметами личной гигиены, такими как бритвенные принадлежности, зубная щетка, на которых могли оставаться частицы крови.
  • Вы перенесли какие-либо операции, в т. ч. стоматологические.

Передается ли вирус гепатита С половым путем?

Да, но это происходит редко. Вероятность заражения половым путем при незащищенном половом контакте с еловеком , инфицированным вирусом гепатита составляет 3-5%. Для снижения риска инфицирования партнера, практикуйте барьерные средства защиты (латексные презервативы).

Можно ли заразиться вирусом гепатита С от членов семьи?

Да, но это происходит редко. Заражение членов семьи происходит при прямом контакте с кровью инфицированного человека.

Можно ли заразиться гепатитом С при татуаже?

Нет данных о передаче вируса гепатита С при татуаже. Однако при отсутствии или плохом инфекционном контроле существует потенциальная возможность передачи вируса.

Возможно ли заражение при уксусах комаров или других кровососущих насекомых?

Вирус гепатита С не передается при укусах комаров и других кровососущих насекомых.

Как часто формируется хроническая инфекция , вызванная вирусом гепатита С?

Приблизительно у 75-85% инфицированных людей развивается хроническая инфекция.

Является ли хронический вирусный гепатит С серьезным заболеванием?

Хронический вирусный гепатит является ведущей причиной цирроза, первичного рака печени и трансплантаций печени. В США, по статистике, от осложнений вирусного гепатита С ежегодно умирает 8-10 тысяч пациентов.

Как долго вирус гепатита С может сохранять жизнеспособность в окружающей среде и заразность?

Вирус гепатита С может выживать на окружающих поверхностях при комнатной температуре по крайней мере 16 часов, но не более 4 дней.

Как проводить дезинфекцию ? Что следует использовать для дезинфекции вируса гепатита С на окружающих предметах?

Следует убрать любые брызги крови, включая высохшую кровь, используя раствор, содержащий одну часть бытового отбеливателя,дезинфектанта и 10 частей воды для дезинфекции поверхности. Используйте перчатки при мытье поверхностей, содержащих кровь.

Как могут инфицированные вирусом гепатита С предупредить распространение вируса среди окружающих?

  1. Не будьте донором крови, органов, других тканей, спермы.
  2. Не пользуйтесь совместно личными принадлежностями, такими как зубные щетки, маникюрные наборы или бритвенные принадлежности, которые могут содержать Вашу кровь.
  3. Заклеивайте свои раны и порезы.
  4. Практикуйте безопасный секс.

Как пациенту с вирусным гепатитом С защитить свою печень?

  1. Прекратите употреблять алкоголь.
  2. Регулярно посещайте врача, имеющего опыт ведения пациентов с вирусным гепатитом.
  3. Не начинайте прием любых новых лекарств, безрецептурных форм, трав, других медикаментов без совета врача.
  4. Вакцинируйтесь против гепатитов А и В.

Что еще следует знать пациенту с вирусным гепатитом С?

Вирус гепатита С не распространяется при кашле, чихании, объятиях, через воду или продукты питания, при использовании общей посуды, чашек, случайных контактах. Не следует, инфицированных вирусом гепатита С, отстранять от работы в школе, ухода за детьми и др. Вовлечение в группу поддержки может помочь пациентам справиться с вирусным гепатитом С.

Может ли вирусный гепатит С проявляться поражением других органов и систем (кроме печени)?

У небольшого процента пациентов с хроническим вирусным гепатитом С могут возникать поражения других органов. Это связано с нарушением иммунной системы, возникновением аутоиммунных реакций , направленных против собственных клеток организма . Эти поражения включают гломерулонефрит, смешанную эссенциальную криоглобулинемию, порфирию и ряд других.

Существует ли вакцина для профилактики Вирусного гепатита С?

Нет.

Какие тесты используются для дигностики гапатита С?

Наиболее доступным методом диагностики является определение Anti-HCV (антител к вирусу гепатита С.) Этот тест является первичным в скрининге. Если он позитивен, его следует подтвердить.Наличие Anti-HCV устанавливает факт инфицирования в прошлом или настоящем.Для точной диагностики гепатита С выполняется следующий этап, ПЦР-диагностика (полисеразная цепная реакция), которая позволяет определить РНК вируса гепатита С в крови. Качественный тест для обнаружения наличия или отсутствия вируса гепатита С подтверждает как наличие инфекции, так и факт репликации (размножения) вирусов в организме.Отрицательная ПЦР не доказывает, что обследуемый не инфицирован: вирус может находиться в крови в незначительном количестве и не определяться методом ПЦР. Негативный результат может быть у инфицированных в прошлом, а также у реконвалесцентов.Если предполагается диагноз вирусного гепатита С и ПЦР негативна, следует повторить анализ. Количественный тест для обнаружения количества вируса гепатита С позволяет судить об 
активности или скороскти размножения вирусов.Чем выше вырусная нагрзка, тем активнее репликация вирусов. Высокая вирусная нагрузка-это фактор, снижающий эффективность противовирусной терапии.

Может ли уровень печеночных ферментов, включая АЛТ быть нормальным при хроническом гепатите С?

Для хронического гепатита С характерны периодические колебания печеночных ферментов. Активность АЛТ может расти и снижаться к нормальным значениям. У некоторых пациентов регистрируются нормальные показатели печеночных ферментов более года, но приэтом продолжается развитие хронического заболевания печени.Если печеночные ферменты в пределах нормы, пациенту следует проконтролировать их несколько раз в течение 6-12 месяцев.Если показатели остаются нормальными , следует контролировать их не реже 1 раза в год.

Через какой период после заражения вирусным гепатитом С возможно определить РНК возбудителя методом ПЦР?

Методом ПЦР вирус гепатита С может быть выявлен через 1-2 недели после инфицирования.

Что означает термин «генотип»?

Термин «генотип» имеет отношение к генетическому строению вруса или организма. Известно по меньшей мере 6 генотипов вируса гепатита С, в Украине наиболее часто 
регистрируется 1 генотип.

Для чего необходимо определять генотип вируса?

Знание генотипа С необходимо для подготовки рекомендаций и тактики лечения. Пациенты с 2 и3 генотипами лучше отвечают на противовирусную терапию, для этих пациентов достаточен 24 недельный курс комбинированной терапии, в то время как пациенты с 1 генотипом нуждаются в более длительном, 48-недельном курсе терапии.

Может ли пациент быть инфицирован различными генотипами вируса?

Да, вследствие непродуктивного иммунного ответа. Предшествующая инфекция не защищает от повторных заражениятем же и другими генотипами вируса. По этим причинам не существует эффективной до и после-экспозиционной профилактики (например, иммуноглобулином).

Для чего необходима биопсия печени?

Биопсия печени — это взятие с помощью специальной иглы небольшого фрагмента ткани печени и изучение его под микроскопом. Биопсия печени необходима, для того чтобы оценить степень повреждения печени особенно при бессимптомном течении заболевания. Это исследование позволяет выявить степень повреждения, контролировать течение болезни и эффективность лечения.

Диагностика состояния ткани печени без биопсии

В настоящее время появились абсолютно безопасные и достаточно достоверные диагностические тесты, позволяющие обнаружить фиброз с самого начала его формирования. Это Фибротест и Фиброскан.

Что такое Фибротест?

Это данные, полученные с помощью запатентованного алгоритма, основанного на определении специфических биомаркеров фиброза в венозной крови пациента с уч?том его возраста, пола, роста и массы тела. Существует несколько разновидностей тестов, которые для удобства оценки их клинической значимости сгруппированы в два комплекса: Фибро/Акти Тест и Фибро Макс.

Что такое Фиброскан?

Это импульсная эластометрия печени (измерение эластичности ткани печени). Принцип метода – плотность печени прямо пропорциональна стадии фиброза.

Чем фибротест и фиброскан отличаются от биопсии печени?

Это малоинвазивные методы, которые обеспечивают более высокую точность при определении ранних стадий фиброза. Фибротест позволяет обнаруживать самые незначительные функциональные сдвиги в работе печени, когда эти сдвиги еще не привели к анатомическим дефектам. Также, эти методы являются незаменимыми, когда имеются противопоказания для проведения биопсии печени, например, при нарушениях свертывания крови.

Беременность и кормление грудью

Обязательно ли беременной женщине обследоваться на анти-HCV?

Нет. Риск инфицирования вирусом гепатита С у беременной не выше чем у небеременной женщины. Однако если беременная женщина имеет факторы риска заражения вирусом гепатита С, ей следует обследоваться на анти-HCV.

Каков риск передачи инфекции от инфицированной вирусом гепатита С женщины к ребенку?

Инфицирование возможно только в родах и предотвратить его сегодня не представляется возможным. По статистике, во время родов 4 из 100 новорожденных от HCV инфицированных матерей становятся инфицированными, большинство из них не имеют симптомов болезни.

Какой риск перинатальной передачи вируса гепатита С если мать также инфицирована вирусом иммунодефицита человека (ВИЧ)?

Если у матери определяется ко- инфекция вирусом гепатита С и ВИЧ, вероятность инфицирования плода может достигать 19%.

Следует ли женщине с вирусным гепатитом С отказаться от кормления грудью?

Нет. Не существует данных о передаче вируса гепатита С при кормлении. Матерям, инфицированных вирусом гепатита C следует рассмотреть отказ от кормления при трещинах или кровотечении из сосков.

Когда следует проводить обследование ребенка, рожденного от матери, инфицированной вирусом гепатита С, на предмет возможного инфицирования при рождении?

Детей до 18 месяцев не следует обследовать, так как до этого возраста могут сохраняться материнские анти-HCV. Если диагноз желательно установить до 18 месяцев, следует провести ПЦР исследование ребенка в возрасте 1-2 месяцев. ПЦР следует повторить при следующем визите независимо от результата первичного обследования.

Лечение хронического вирусного гепатита С

Лечение вирусного гепатита нужно начинать как можно раньше!
Чем раньше начата терапия, тем больше шансов на полное излечение!

На сегодняшний день, самым эффективным во всем мире признано лечение комбинацией пегилированного интерферона и рибавирина. Применение этой схемы, позволяет достичь стойкого вирусологического ответа у 60-95% пациентов (до 60% у пациентов, инфицированных наиболее часто встречающимся 1генотипом, и до 95% у пациентов, инфицированных генотипами 2 и 3). Изолированое применение интерферона является вариантом лечения пациентов, которым противопоказан рибавирин. Рибавирин при самостоятельном применении неэффективен.

В каких случаях гепатит С труднее поддается лечению?

Согласно статистике, труднее поддается лечению гепатит С у мужчин, людей старше 40 лет, у пациентов с избыточным весом, у пациентов с нормальной активностью трансаминаз, при высокой вирусной нагрузке, у имеющих 1 b генотип вируса. Наличие цирроза печени к моменту начала лечения ухудшает прогноз.

Что будет, если после проведенного курса лечения пациент не попадет в число излечившихся?

Предусмотрены курсы и специальные схемы повторной терапии для людей, у которых результат лечения не был достигнут или оказался неполным (возник рецидив инфекции 
сразу после лечения).

Препараты и протоколы терапии гепатита С постоянно совершенствуются, их эффективность растет и может оказаться выше, чем предшествующая схема лечения, не давшая желаемого результата.

Даже при отсутствии стойкого вирусологического ответа, интерферонотерапия уменьшает выраженность фиброза в печени и позволяет значительно продлить время до наступления таких грозных осложнений вирусного гепатита С, как цирроз печени и гепатоцеллюлярная карцинома.

Можно ли заразиться и заболеть гепатитом С повторно?

Да, можно заразиться и заболеть повторно. Даже если проведенное лечение было успешным, иммунитет к вирусу гепатита С не вырабатывается, поэтому повторное инфицирование (в том числе и другим типом HCV) вызывает заболевание.

Какие противопоказания к противовирусной терапии?

  • Клинически значимые сопутствующие заболевания (злокачественные опухоли, нестабильная стенокардия, тяжелое обструктивное заболевание легких).
  • Клинически декомпенсированное заболевание печени*.
  • Неконтролируемые аутоиммунные заболевания.
  • Беременность или планируемая беременность у пациентки или у полового партнера пациента, или нежелание использовать адекватный контроль беременности.
  • Документально подтвержденное отсутствие приверженности пациента предшествующему лечению или невозможность завершить назначенные обследования.
  • Тяжелые неконтролируемые психиатрические заболевания, в частности депрессия с риском суицида.
  • Употребление инъекционных наркотиков в настоящее время.
  • Злоупотребление алкоголем в настоящее время.
  • Возраст младше 3 лет.
  • Лица с индивидуальной непереносимостью любого препарата для лечения гепатита C.

Какие исследования необходимо провести до начала терапии?

Вам необходимы ежемесячные консультации лечащего врача, для осмотра и оценки результатов лабораторных исследований, а также для того, чтобы побочные эффекты лечения или осложнения были вовремя распознаны и скорректированы, а серьезные нежелательные явления вовсе не развились.

Обязательные исследования

  1. Обследование на наличие депрессии и прием алкоголя.
  2. Биохимические маркеры повреждения печени и оценка функции печени, включая определение уровня АЛТ, альбумина, билирубина (в частности прямого), протромбинового времени.
  3. Количество лейкоцитов, уровень гемоглобина, гематокрита, тромбоцитов.
  4. Определение функции щитовидной железы.
  5. Креатинин сыворотки.
  6. Глюкоза сыворотки или гликозилированный гемоглобин (HbA1С) у пациентов с сахарным диабетом.
  7. Тест на беременность (у женщин детородного возраста).
  8. Определение ВИЧ-инфекции.
  9. HBsAg, Anti-HBc, anti-HBs, anti-HAV (суммарные).
  10. Количественное определение РНК ВГС.
  11. Генотип ВГС.
  12. ЭКГ.

Желательные

  1. Биопсия печени для определения степени тяжести заболевания печени (в частности при 1 генотипе ВГС), фибротест, фиброскан.
  2. Обследование глазного дна на предмет выявления ретинопатии у пациентов с сахарным диабетом и артериальной гипертензией.
  3. Ферритин сыворотки, насыщение железом, антинуклеарные антитела.
  4. Токсикологическое исследование мочи на наличие опиатов, кокаина, амфетаминов.

Могут ли дети с хроническим вирусным гепатитом получать интерферонотерапию?

Управлением по контролю за продуктами и лекарствами (США) одобрена к применению комбинация противовирусных препаратов для лечения вирусного гепатита С начиная с 3 лет.

Что такое ко-инфекция?

Термин ко-инфекция означает одновременное наличие двух или более вирусов. Поскольку пути передачи при вирусных гепатитах В, С и ВИЧ сходны, то возможно одновременное заражение двумя или даже тремя вирусами.

Гепатит В / гепатит С коинфекция

Подобно гепатиту С, гепатит В может привести к тяжелому повреждению печени, включая цирроз и первичный рак печени. HBV/HCV коинфекция мало изучена , однако проведенные исследования свидетельствуют о том, что коинфекция может привести к более тяжелому повреждению печени, чем инфицирование только одним из вирусов.

Какова распространенность ВГС-инфекции среди потребителей инъекционных наркотиков?

Самые последние обзоры показывают, что одна треть молодых людей, потребителей инъекционных наркотиков (в возрасте 18- 30 лет), инфицированы ВГС. Инфицированность в группе пожилых и бывших потребителей инъекционных наркотиков, как правило, выше и составляет 70%- 90%.

Каков риск заражения вирусным гепатитом С при употреблении кокаина?

Имеются ограниченные эпидемиологические данные, указывающие на дополнительный риск, связанный с употреблением кокаина.

Каковы особенности вирусного гепатита С у ВИЧ- инфицированных?

Большинство исследований свидетельствует о том, что ВИЧ- инфекция приводит к более агрессивному течению гепатита С.

Не существует единого мнения о том, когда следует начинать лечение ВИЧ-инфекции. Согласно последним данным, в лечении нуждаются пациенты с количеством CD4 ниже 350 клеток в 1 мм3 , а вирусная нагрузка превышает 55000 копий в 1 мл. Стандартный режим лечения ВИЧ-инфекции предусматривает комбинированное применение нескольких антиретровирусных препаратов.

ВИЧ инфекция может эффективно лечиться у большинства пациентов с вирусным гепатитом С. Некоторые препараты, использующиеся при лечении ВИЧ инфекции, такие как, например, ингибиторы протеаз могут причиной временного повышения АЛТ и других биохимических печеночных показателей. Большинство пациентов с вирусным гепатитом С могут принимать препараты для лечения ВИЧ –инфекции при условии тщательного мониторинга показателей печени.

Общие правила лечения HCV-инфекции могут быть применены и у ВИЧ-инфицированных пациентов. Лечение гепатита С у таких пациентов требует больших усилий и должно быть более длительным. ВИЧ-инфицированные пациенты с содержанием CD4 менее 200 клеток в 1 мм3, не считаются хорошими кандидатами для лечения HCV-инфекции и первично нуждаются в 
антиретровирусной терапии.

Важность принятия решения о противовирусной терапии

В долгосрочной перспективе, лечение- Ваш лучший шанс остаться здоровым, насколько это возможно и как можно дольше.

Состояние пациентов, не получающих лечения не становится лучше: вирус продолжает разрушать печень. Пациенты, начавшие противовирусную терапию раньше, отвечают на лечение лучше.

Начинать прием противовирусной терапии или нет — одно из наиболее значимых решений, которое Вы принимали в жизни. Многим лечение помогает снизить вирусную нагрузку в крови до неопределяемых значений, и оказывает положительное влияние на структуру печени.

Курс противовирусной терапии для многих представляется сложной и длительной задачей, и всегда кажется легче вообще ничего не делать, а ждать лучшего или более удобного случая в будущем. Это очень заманчиво: постоянно, под каким- либо предлогом откладывать лечение. Шесть месяцев или 1 год лечения не столь длительный отрезок времени как представляется сразу, если Вы хотите сохранить качество своей жизни и здоровье.

Будьте откровенны с собой и ответьте на следующие вопросы:
Была ли противовирусная терапия более успешной и эффективной чем сейчас?
Буду ли я когда-нибудь более сильным, здоровым, более готовым для принятия решения, чем я сейчас?

Ответ на первый вопрос прост. Мы узнали о гепатите С многое и в лечении достигнут определенный прогресс.

Ответ на второй вопрос Вы можете сформировать, общаясь со своим врачом.

Осознанно приняв решение о терапии, Вы можете закончить лечение с хорошим результатом и почувствовать себя лучше. Многие пациенты закончили лечение успешно. Просто завершить лечение это успех сам по себе. Умение справляться со стрессом является важным фактором контроля во время терапии. Жизнь с хроническим заболеванием сопряжена со стрессом. Попытайтесь сохранить реалистическое представление о состоянии Вашего здоровья и позитивное отношение к жизни.

Необходимо знать , что на фоне терапии хронического гепатита С могут возникать побочные эффекты, связанные с приемом противовирусных препаратов. Побочные эффекты различны у каждого пациента. Некоторые пациенты не отмечают побочных эффектов, другие же обращают внимание на плохую переносимость препаратов.

Если Вы получаете противовирусную терапию:

Необходимо правильно распознавать возникающие у Вас побочные эффекты. Следует изучить, как справляться с побочными эффектами, включая ситуации, когда необходимо обратиться за помощью к врачу.

Следует знать, какие побочные эффекты являются серьезными и что при их развитии Вы должны немедленно обратиться к врачу.

Побочные эффекты лечения всегда должны оцениваться и контролироваться врачом.

Важным компонентом успешного контроля побочных эффектов является создание группы поддержки перед началом лечения , в которую могут войти члены вашей семьи и друзья.

Сохранение положительного настроя во время лечения очень трудная и важная задача. Не существует научных данных, как влияет общий настрой пациента на процесс лечения. Тем не менее, многие пациенты сообщают, как важно сохранять позитивное мышление. Положительное отношение представляет собой процесс, а не окончательную цель. Не программируйте себя на неудачу. Будьте внимательны к себе.

Как сохранить положительное отношение на протяжении лечения?

Перед началом лечения, составьте список причин, почему вы начали лечение, постоянно перечитывайте его, когда Вам трудно. Причины, которые побудили вас начать лечение могут быть разными:
Для того, чтобы улучшить свое здоровье.
Для того, чтобы жить дольше.
Для того, чтобы почувствовать, что вы сделали все, что вы можете сделать.
Чтобы жить для ваших детей, внуков, близких.
Для того, чтобы просто избавиться от вируса.
Для того, чтобы уменьшить симптомы гепатита и повысить качество жизни.
Для предотвращения цирроза и рака печени.
Для того, чтобы не стать обузой для других.

Просыпаясь утром, с благодарностью думайте о тех людях, которые поддерживают вас во время лечения, и том, что вы имеете возможность принимать лечение. Каждый вечер напоминайте себе, что еще один день лечения завершен и Вы на один день ближе к вашей цели, завершению лечения. Сохранять хорошее настроение гораздо легче, если вы следите за собой постоянно. Если Вы хорошо выглядите, то в целом Вы и чувствуете себя лучше.

Старайтесь следовать следующим советам:

  • Принимайте душ или ванну ежедневно.
  • Слушайте успокаивающую музыку.
  • Позаботьтесь о красоте ваших рук и ногтей.
  • Постоянно увлажняйте кожу.
  • Позаботьтесь о свой прическе, она должна быть привлекательной и за ней должно быть легко ухаживать.
  • Мужчины не забывайте о бритье.
  • Женщины, если Вы регулярно использовали макияж до начала терапии, не забывайте это делать во время лечения.
  • Одевайтесь, даже если Вы весь день проведете на диване, выбирайте комфортную одежду.
  • Носите цвета, которые помогут Вам чувствовать себя лучше.

Умеренные физические упражнения настоятельно рекомендуются всем пациентам, инфицированным ВГС , кроме тех, у кого острый гепатит. Физическая активность улучшит общее состояние и поможет Вам оставаться позитивно настроенным и целеустремленным. Физические упражнения могут ослабить стресс и помочь вам в поддержании хорошей физической формы. Однако чрезмерные занятия спортом могут вызвать обострения заболевания. Выбирайте легкие виды физических упражнений, например: ходьба, хула-хуп, плавание, танцы, садоводство, йога, практика цигун.

Медленно увеличивайте нагрузку до достижения желаемого уровня. Обсудите со своим врачом, прежде чем приступить к выполнению любой программы физических упражнений.

Регулярные физические упражнения способствуют:

  • Повышению мышечной массы, силы и выносливости.
  • Улучению энергетического потенциала.
  • Уменьшению стресса.
  • Повышенинию прочности костей.
  • Снижению уровня холестерина и триглицеридов.
  • Повышению аппетита.
  • Улучшению сна.
  • Стабилизизации или предотвращению снижения CD4 клеток у ВИЧ-инфицированных.

Однако не переусердствуйте! Двадцатиминутные занятия, по крайней мере 3 раза в неделю, приведут к значительному улучшению в вашем физическом состоянии, и вы сможете почувствовать себя лучше. Выберите занятия, которые нравятся вам.

Несколько рекомендаций по режиму питания при вирусном гепатите С:
Придерживайтесь здоровой и сбалансированной диеты с большим количеством овощей и фруктов.
Попытайтесь воздержаться от избытка сахара, соли и жирной пищи.
Читайте все этикетки, чтобы ознакомиться с ингредиентами приобретаемых вами пищевых продуктов.
Наиболее полезными могут оказаться белки из мяса, птицы, рыбы и растительных источников.
Не ешьте сырые или недоваренные моллюски, т.к. они вредны пациентам с гепатитом С.
Избегайте приема больших доз витаминов А и Д.
Не принимайте витамины и травы без консультации врача.

При появлении каких симптомов следует немедленно связаться с врачом?
Тяжелая депрессия.
Мысли навредить себе или другим.
Боль в груди.
Стойкое повышение температуры тела, ее нарастание.
Снижение четкости зрения, потеря зрения.
Затрудненное дыхание (одышка при физических нагрузках при напряжение является общим с терапией).
Рецидив псориаза.
Кровавый понос.
Необычное кровотечение или кровоподтеки.
Сильные боли в животе или спине.
Беременность

Какие препараты не следует принимать, во время приема противовирусной терапии?

Вы не должны принимать диданозин во время приема рибавирина. Поговорите со своим врачом по поводу всех лекарств, которые вы принимаете.

Руководство по побочным эффектам противовирусной терапии

Почти у всех пациентов, принимающих пегилированные интерфероны, во время лечения возникают гриппоподобные симптомы, такие как мышечные и суставные боли, головная боль, озноб и повышение температуры тела. Чаще всего эти симптомы возникают через 2-24 часа после введения инъекции. К счастью, они, как правило, наиболее выражены в начале лечения. Гриппоподобные симптомы неприятны, однако Вы можете справиться с ними.

Температура

Появление температуры связано с приемом пегиллированного интерферона. Повышение температуры, как правило, более выражено после первых нескольких иньекций и, обычно, встречается в первый или второй день после введения интерферона.

Немедленно обращайтесь за помощью если:
Температура выше 38° С, и длится больше суток;
При появлении озноба или выраженной слабости;

В данном случае температура может быть связана с инфекцией, и Вы нуждаетесь в специфическом лечении. Ваш Врач выяснит, с чем связана Ваша ситуация.

Рекомендации

Обсудите с Вашим врачом прием парацетамола или ибупрофена* за полчаса до введения пегиллированного интерферона либо после инъекции, когда у Вас появляется температура. Это может уменьшить температуру, связанную с инъекцией. Пейте достаточно жидкости, при весе 70 кг Вам следует выпивать не менее 8 стаканов воды в сутки.Посетите врача, если Ваша температура:
выше 38° С, если это не следует после инъекции интерферона.
выше 38° С: повторяющаяся или длящаяся более чем 24-48 часов.

* Предостережение: повышенные дозы парацетамола вызывают тяжелые необратимые изменения в печени, усиливающиеся с одновременным приемом алкоголя. Прием Ибупрофена увеличивает риск желудочно-кишечных кровотечений у пациентов, принимающих антикоагулянты и стероиды, риск усиливается с одновременным приемом алкоголя.

Мышечные боли

Мышечные боли это — результат воспаления в мышцах, возникающий на фоне приема пегиллированного интерферона. Рибавирин также может вызвать воспаление мышц и потерю жидкости в ваших кровяностных сосудах, что может привести к мышечным болям (дегидратация частично является причиной болей в мышцах после длительных физических упражнений).

Рекомендации
Обсудите с Вашим доктором прием парацетамола, или ибупрофена, для уменьшения болей в мышцах.
Выполняйте упражнения средней интенсивности.
Используйте теплую, влажную махровую мочалку для растирания болезненных участков.
Принимайте теплые ванны.
Пейте больше жидкости.

Головная боль

Около 60% пациентов, принимающих противовирусную терапию, беспокоит головная боль. Стресс, бессонница, неправильное питание могут быть причиной головой боли. Головная боль может быть связана и с прямым результатом действия интерферона, а также анемией (низким количеством красных кровяных телец), вызванной приемом рибавирина.

Рекомендации
Пейте больше жидкости.
Спите больше.
Принимайте теплые, успокаивающие ванны.
Отдыхайте в тихой, темной комнате.
Попытайтесь уменьшить уровень стрессов.
Если Вы испытываете постоянную головную боль более 24 часов, немедленно свяжитесь с Вашим лечащим врачом.
Обсудите прием парацетамола или ибупрофена* со своим доктором
Если у Вас были приступы мигрени (определенный тип головной боли, часто сопровождающийся зрительными нарушениями), обсудите со своим доктором возможность приема медикаментов
Избегайте громких звуков, яркого света, алкоголя, кофеина и пищевых продуктов, содержащих тирамин (например, сыр и шоколад), и фенилаланин (используется в качестве искусственных подсластителей).

Психическое здоровье

Плохой сон

У многих пациентов, получающих противовирусную терапию, возникают проблемы со сном. Это происходит в связи со стимуляцией (возбуждением) определенных зон тела. Отсутствие сна может спровоцировать другие побочные эффекты, включающие слабость, вспыльчивость, ухудшение настроения и головную боль, и намного ухудшить общее состояние. Полноценный сон и отдых-ключ к успешному лечению.

Рекомендации
Сделайте восьмичасовой сон регулярной привычкой.
Откажитесь от чтения и просмотра телевизора в постели.
Выключайте телевизор и компьютер за час до сна.
Старайтесь ложиться спать и подниматься в одно и то же время.
Старайтесь немного поспать днем.
Ограничьте употребление жидкости в вечернее время, чтобы избежать посещений туалета ночью.
Если при приеме рибавирина Вы чувствуете беспокойство, принимайте таблетки в 16 или 17 часов, вместо приема непосредственно перед сном.
Избегайте приема большого количества пищи, избытка упражнений, табака и кофеина перед сном.
Регулярно делайте небольшие физические упражнения, однако воздерживайтесь от физических упражнений, по крайней мере, за 4 часа до сна.
Ромашковый чай является одним из наиболее широко используемых отваров для улучшения сна. Для лучшей релаксации поместите вблизи кровати небольшие подушечки с травой лаванды или хлопчатобумажные кусочки ткани, смоченные маслом лаванды. Однако помните, если Вы используете травы, будьте очень осторожны.

Чувство страха и тревоги

Многие пациенты отмечают беспокойство во время противовирусной терапии. Это побочный эффект препаратов, особенно интерферона, его сложно предупредить. Вы можете чувствовать тревожность и нервное напряжение.

Рекомендации
Используйте релаксирующие технологии (йога, медитация, глубокое дыхание)
Избегайте стимуляторов, таких как кофеин (кофе и чай).
При ухудшении самочувствия расскажите врачу о своих симптомах, и он порекомендует Вам препараты для улучшения Вашего самочувствия.

Вспыльчивость

Многие пациенты, принимающие противовирусную терапию сердятся из-за вещей, которые в обычном состоянии не вызывают у них эмоций. Это может случиться даже с людьми, которые никогда, не раздражались. Вы можете обнаружить, что кричите на людей в транспорте, хотя это ранее никогда с Вами не случалось. Осознавая наличие вспыльчивости, Вы можете ожидать и контролировать это состояние лучше. Если члены Вашей семьи и друзья знают, что Вы принимаете лечение, которое может быть причиной Вашего безрассудного поведения, им легче будет понять Вас.

Рекомендации
Используйте релаксирующие технологии (йога, медитация, глубокое дыхание).
Дышите глубже, посчитайте до 10.
Делитесь своими чувствами с друзьями и членами семьи.
Присоединяйтесь к группе поддержки.
Если Вы устали, у Вас подавлено настроение, или пропал сон, найдите пути, чтобы справиться с этими побочными эффектами.
Попытайтесь сделать так, чтобы Ваша работа приносила меньше стрессов.
Например, обсудите с Вашим начальством гибкий график работы, если это может помочь Вам.

Депрессия и уныние

Посмотрим правде в глаза, любое хроническое заболевание может вызывать подавленное настроение. Поэтому не удивительно, что многие пациенты чувствуют себя бесполезными и виновными. Депрессия представляет собой целый спектр различных симптомов. Ее типичными симптомами являются:
Тоска, печаль, тревога или раздражительность.
Трудности засыпания, повторяющиеся пробуждения ночью или слишком раннее пробуждение.
Потеря интереса к работе, еде, сексуальной жизни.
Чувство вины и собственной неполноценности, безнад?жность в отношении будущего.
Трудности сосредоточения и постоянная усталость.
Потеря веса или же, наоборот, прибавка в весе.
Излишняя озабоченность собственным здоровьем.
Мысли о самоубийстве и смерти.

Противовирусная терапия может привести к усилению симптомов депрессии, обычно ее симптомы проявляются в течение первых четырех недель с начала лечения, хотя депрессия может начаться в любой момент терапии. Если Вы страдали депрессией до начала терапии, сообщите об этом врачу — Вам помогут справиться с этим состоянием.

Прием пегиллированного интерферона обычно вызывает чувство бессилия. Если Вы находите свое состояние более чем слегка обессилевшим — возможно Вы чувствуете себя 
никчемным, бесполезным, или доведенным до полного отчаяния, потерявшим интерес к своему любимому занятию — у Вас депрессия. Это состояние может быть откоррегировано 
изменением дозы интерферона или назначением антидепрессантов. После окончание терапии эти ощущения пройдут в течение 1-2 недель.Обязательно обсуждайте свое состояние с врачом. Для Вас важно иметь круг общения, с которым вы можете поделиться своими чувствами и сомнениями во время лечения. Ваша семья и друзья могут стать для Вас источником поддержки и помогут справиться с Вашими тревогами.

Рекомендации
Если Вы чувствуете, что способны принести себе вред или подумываете о суициде, немедленно обратитесь за помощью.
Делайте то, что приносит Вам удовольствие, например, читайте книги, посещайте любимые кафе, спектакли, музеи.
Учитесь управлять своими эмоциями.
Выработайте привычки: есть, ложиться спать, принимать лекарство в одно и то же время.
Избегайте употребления большого количества сахара.
Ведите дневник любых негативных мыслей и чувств, которые влияют на Ваше настроение; это поможет Вам и Вашему врачу быть в курсе, как вы чувствуете себя ежедневно.
Для Вас важно иметь круг общения, с которым вы можете поделиться своими чувствами и сомнениями во время лечения. Ваша семья и друзья могут стать для Вас источником поддержки и помогут справиться с Вашими тревогами. Проводите время с людьми, которые способны Вас поддержать.
Присоединяйтесь к группам поддержки.
Обсудите с Вашим доктором возможности коррекции депрессии.
Помните, что депрессия — контролируемое состояние.
Если вы принимаете лекарства от депрессии, убедитесь, что Вы правильно следуете инструкциям Вашего врача.
Увеличьте потребление кислот омега-3.

Усталость

Пациенты, страдающие гепатитом, обычно ощущают усталость и слабость.

Усталость один из первых побочных эффектов противовирусной терапии. Отчасти это связано с тем, что интерферон стимулирует Вашу иммунную систему, а рибавирин оказывает токсическое воздействие на красные кровяные тельца, их уменьшение (это состояние называется «анемия»). Нарушение функций щитовидной железы, сопровождающееся снижением уровня гормонов щитовидной железы может тоже вызывать усталость.

Рекомендации
Изучите пределы своих возможностей, и не перетруждайте себя. Выполняйте только те виды деятельности, которые действительно необходимо сделать.
Старайтесь ложиться спать и подниматься в одно и то же время каждый день.
Планируя, какие либо занятия предусмотрите перерывы для отдыха или кратковременного сна.
Регулярно выполняйте небольшие физические упражнения, однако воздерживайтесь от физических упражнений, по крайней мере, за 4 часа до сна.
Следите за своей осанкой.
Ешьте здоровую пищу для поддержания своего веса.
Не забывайте пить много воды в течение всего дня, особенно после приема таблеток.
Если слабость значительна в течение 1-2 дней после инъекции интерферона, примите от 325 до 1000 мг парацетамола* до введения инъекции. (Посоветуйтесь с врачом об этом.
Не забывайте, что здоровье — важнее всего. Научитесь говорить «нет» своим друзьям и родным, которые переоценивают Ваши силы, попросите их помочь Вам.

Потеря концентрации, памяти и способности ясно мыслить

Советы для улучшения памяти:
Регулярно ведите дневник приема лекарств и побочных эффектов.
Не забывайте брать с собой медикаменты, помещайте их в специальный контейнер.
Используйте установки таймера на наручных часах, будильнике, электронном органайзере или компьютере, напомнающие вам о приеме лекарств.
Выработайте привычку планировать день накануне вечером.
Выполняйте одно задание за раз, а не нескольких задач одновременно.
Обратите внимание на то, что вы хотите запомнить, повторите несколько раз.
Используйте стикеры с напоминаниями о ваших планах.

Полость рта, желудок, пищеварение

Противовирусная терапия может привести к снижению аппетита. Важно придерживаться полноценной диеты во время проводимой терапии и впоследствии. Ваш организм нуждается в хорошем питании и здоровой пище в борьбе с вирусом гепатита С и восстановлении повреждений, вызванных им.

Рекомендации
Совершайте прогулки или расслабляющие физические упражнения до приема пищи. Это может повысить Ваш аппетит.
Принимайте пищу 5-6 раз в сутки небольшими порциями вместо трехразового питания. Например, 8:30 – завтрак, 10:00 – легкая закуска, 12:30 – обед, 15:00 – легкая закуска, 17:30 – ужин и 19:30 – легкая закуска.
Ешьте Вашу любимую пищу, даже если Вы едите немного.
Пейте свежеприготовленные домашние напитки с пищевыми добавками вместо приема пищи. Пейте напитки через соломинку, если Вы находите их запах менее аппетитным.
Храните такие закуски как вареные яйца, сыр, масло в доступных местах. Храните закуски, которые не требуют хранения в холодильнике возле кровати или телевизора.
Запасайтесь небольшими порциями замороженных продуктов, их легко и просто приготовить.
Старайтесь использовать различные виды продуктов для приготовления наиболее интересных блюд.
Смотрите телевизионные передачи по приготовлению пищи.
Сделайте прием пищи приятным — ешьте с другими, ешьте в приятном месте, со свечами.
Если возможно, не пейте жидкость одновременно с приемом пищи. Это сделает Вас сытым раньше.

Неприятный вкус во рту, изменение вкуса

Пегиллированный интерферон может быть причиной горького или металлического вкуса во рту. Рибавирин может стать причиной воспаления ротовой полости и обезвоживания, что создает сухость и неприятный вкус во рту.

Рекомендации
Пейте много воды.
Кислая пища может маскировать металлический привкус. Пейте апельсиновый, клюквенный, ананасовый сок и лимонный напиток. Добавляйте к блюдам яблочный уксус, лимонный сок, рассол или приправы.
Маринуйте мясо, курицу рыбу или индейку в яблочном уксусе, вине, майонезе, соевом соусе. Добавляйте свежие и сухие травы или приправы к (такие как лук, чеснок, чили, розмарин, тмин, базилик, ореган (мяту), тимьян, горчицу, хрен, кетчуп).
Избегайте консервированных продуктов питания. Ешьте свежие или замороженные продукты.
Ешьте холодные продукты такие как фруктовое мороженое, шербет, фруктовый, замороженный йогурт для эффекта «замораживания» вкусовых сосочков. Ешьте замороженный виноград, апельсиновые дольки или кусочки дыни и арбуза. Употребляйте лимонные леденцы, которые помогут Вам уменьшить или избавиться от дурного вкуса во рту, который не исчезает после еды.
Не ешьте цитрусовые и не пейте цитрусовые соки непосредственно перед или после чистки зубов.
Ешьте черный шоколад.
Полощите до еды рот чаем, сол?ной водой, или водой с добавлением пищевой соды. Это поможет освежить вкусовые ощущения.
Используйте стеклянную, фарфоровую посуду, пластиковую упаковку вместо металлической.
Соблюдайте гигиену ротовой полости.
Помните, что ваши вкусовые качества восстановятся после завершения терапии.

Сухость во рту и густая слюна

Рибавирин разрушает красные кровяные тельца, в результате чего происходит дегидратация. Это вызывает сухость во рту или сгущение слюны.

Рекомендации
Используйте несодержащие сахар конфеты, ледяные кубики, жевательные резинки для увлажнения ротовой полости.
Начинайте и заканчивайте день стаканом воды.
Добавляйте в пищу соусы, соки, йогурты.
Макайте хлеб, крекеры, печенье в суп, молоко, сок или горячий шоколад.
Держите возле кровати стакан с жидкостью на случай, если Вы заходите пить ночью.
Полощите рот слабым солевым раствором.
Пейте больше жидкости, воды с соком лимона, чай с лимоном.
Посоветуйтесь с врачом относительно других увлажнителей ротовой полости для лечения сухости во рту.

Воспаление ротовой полости и горла

Всем пациентам рекомендуется осмотр, и лечение у стоматолога до начала лечения. Во время лечения возможно воспаление ротовой полости и горла. Если у Вас обычно имеются язвочки в ротовой полости, во время лечения состояние может ухудшиться в результате снижения иммунитета. Посоветуйтесь со своим врачом: многие факторы могут вызвать стоматит и афтозные поражения ротовой полости.

Рекомендации
Соблюдайте гигиену ротовой полости.
Пользуйтесь мягкой зубной щеткой.
Не используйте зубные пасты, содержащие лаурил сульфат натрия.
Пейте много воды. Адекватная гидратация важна для поддержания здоровья, особенно в течение лечения гепатита. Ешьте измельченные продукты или пюре. Детское питание может прекрасно заменить другие продукты.
Пейте нектары вместо соков.
Пейте растворимые напитки или молочные коктейли вместо твердой пищи.
Используйте соломинку.
Ешьте теплую или холодную пищу, но не горячие блюда.
Полощите ротовую полость теплой, подсоленной водой.
Посоветуйтесь со своим врачом относительно применения лидокаина при уходе за ротовой полостью. Это может облегчить дискомфорт при воспалении ротовой полости.
Ведите пищевой дневник, чтобы выявить возможную причину воспаления и исключить из рациона продукты, вызывающие воспаление.
Используйте чай и травы, содержащие высокое содержание танина (ромашка, шалфей, мята перечная) для полоскания полости рта.
Посоветуйтесь с врачом относительно приема пробиотиков, содержащих Lactobacillus.
Прием эхинацеи может ускорить процесс заживления афт, однако у пациентов с ВИЧ, прием эхинацеи противопоказан.

Воздержитесь от:
Соленой, кислой, содержащей специи пищу.
Грубой пищи, подобной сухим тостам, мюслям.
Порошка чили, горячего соуса, переца, карри, гвоздики, мускатного ореха.
Напитков, содержащие карбонатные соли (кола).
Цитрусовых (апельсины или грейпфруты).

Тошнота и рвота

Тошнота-это частый побочный эффект,причиной ее возникновения может быть как интерферон, так и рибавирин. Повторяющаяся рвота может привести к дегидратации и нарушению химического равновесия в организме. При частой рвоте или тошноте проконсультируйтесь в своего врача.

Рекомендации

Попытайтесь:
Придерживаться диеты, содержащей бананы, рис, яблочный соус, чай и тосты.
Ешьте небольшими, закусочными порциями каждые 2-4 часа, вместо 2 или 3 разового питания.
Принимайте рибавирин во время приема пищи.
Ешьте прохладную или охлажденную до комнатной температуры пищу. Хороши фрукты или сандвичи с охлажденными кусочками сыра. Горячая пища может способствовать возникновению тошноты и рвоты. 
При рвоте поддерживайте себя супами, соками, замороженными фруктами.

Продукты, которые помогут справиться с тошнотой и рвотой:
Соленые продукты, такие как крекеры, кренделя.
Мятный, ромашковый, имбирный чай, успокоят Ваш желудок.
Холодная минеральная вода с газом.
Посоветуйтесь со своим врачом относительно использования лекарственных средств, уменьшающих тошноту.

Чего следует избегать:
Не ложитесь на протяжении часа после еды.
Избегайте запахов и продуктов, которые вызывают тошноту. Открывайте окна, чтобы уменьшить запах приготовляемой пищи.
Не ешьте, в период сильной тошноты.
Избегайте очень сладких, горячих, жирных, содержащих специи, сильно пахнущих продуктов.

Понос

Во время терапии может возникнуть понос (диарея). У некоторых пациентов диарея является проявлением побочных эффектов. Диарея может стать причиной дегидратации и слабости, поэтому очень важно восполнить утраченные потери жидкости.

Рекомендации
Используйте диету, содержащую бананы, рис, яблочное пюре, чай и тосты. Ешьте часто, небольшими порциями.
Для восполнения утраченной жидкости, пейте различные напитки (воду, травяные чаи) комнатной температуры на протяжении дня.
Ешьте продукты, содержащие высоки процент растворимой клетчатки: овсянку, рис, бананы, яблочное пюре, фруктовое желе.
Пейте и ешьте продукты, содержащие высокий процент калия карбоната, вещества, которое теряется при поносе. Его содержат бананы, помидоры без кожицы, рыба, курица, мясо, абрикосовый, апельсиновый, манговый и персиковые соки.
Исключите острую, жареную, жирную пищу.
Выпивайте стакан жидкости после каждой дефекации.
Посоветуйтесь с врачом относительно приема лекарственных средств против поноса.

Чего следует избегать:
Избегайте жирной, жареной, острой и слишком сладкой пищи.
Ограничьте напитки, содержащие кофеин, такие как кофе и кола.
Не употребляйте молочные продукты на протяжении трех дней после нормализации симптомов.
Избегайте продуктов и напитков, способных вызвать спазмы и вздутие, таких как бобы, капуста, брокколи, брюссельская капуста, свежий перец, газированные напитки, лук.
Ограничьте использование не содержащих сахар жевательных резинок, конфет с сорбитолом.

Потеря веса

Чрезмерная потеря веса может стать серьезной проблемой при лечении. Правильное сбаласированное питание является важным элементом поддержания общего состояния в течение лечения. Большинство пациентов отмечают , изменение веса в ходе лечения. К сожалению, потеря веса, может быть связана с побочными эффектами терапии и потерей мышечной ткани. Физические упражнения, как и сбалансированная диета, имеют важное значение, поскольку увеличивают мышечную массу, стимулируют аппетит, снижают уровень депрессии и тревоги.

Причины потери веса должны быть выявлены и скорректированы вашим врачом.

Советы по предотвращению потери веса:

  • Проконсультируйтесь с диетологом относительно выбора продуктов питания.
  • Выбирайте продукты с высоким содержанием калорий и белка.
  • Пейте соки в дополнение к воде.
  • Добавьте в рацион регулярное употребление молока, молочных коктейлей, молочных супов, яиц, картофельного пюре, выпечки.

Кожа и волосы

Противовирусная терапия может привести к чрезмерному выпадению волос (облысение), а также изменению текстуры волос. Такие изменения могут происходить по всему телу, а не только на голове. Одного из трех пациентов, принимающих противовирусную терапию, беспокоит ломкость и выпадение волос, цвет волос становится тусклым.

Выпадение волос может быть также симптомом нарушения работы щитовидной железы, и всем пациентам, которые жалуются на этот симптом, следует пройти обследование функции щитовидной железы Большая потеря волос /изменение структуры волос происходят более часто после 3-4 месяцев лечения. Волосы обычно выпадают понемногу, а не обильно как при химиотерапии. После окончания терапии, Ваши волосы начнут медленно расти, и восстановятся в прежней толщине. Важно знать, что миноксидил ( его содержат шампуни VICHI) не дает желаемого эффекта при интерферон-индуцированной потере волос. Фактически, миноксидил может вызвать раздражение и сухость кожи, нежелательные при терапии.

Рекомендации

  • Не мойте волосы слишком часто.
  • Носите головной убор.
  • Используйте расчески с широкими зубьями или мягкую щетку, не расчесывайте волосы слишком часто.
  • Не сушите волосы феном, не завязывайте волосы туго, и збегайте химических красителей и перманентов.
  • Реже используйте гели, спреи, лаки, муссы для волос, особенно содержащие алкоголь.
    Используйте мягкие шампуни.
  • Спите на сатиновой наволочке, для снижения трения волос.
  • Не используйте лекарства от выпадения волос – они не эффективны при выпадении волос, связанном с приемом интерферона

Изменения ногтей

Противовирусная терапия может повлиять на структуру ваших ногтей, они могут стать сухими и ломкими.

Советы по уходу за ногтями:
Длина ногей долна быть короткой.
Используйте лосьоны и кремы для рук , так часто, насколько это возможно,особенно после того как ваши руки были в воде.
Носите перчатки для защиты рук при мытье посуды, уборке, садоводческих работах, стирке, работах с использованием химических веществ.
Перед сном, смазывайте руки жирным кремом, надевайте специальные хлопчатобумажные перчатки.
Используйте индивидуальные маникюрные принадлежности.
Если вы пользуетесь услугами маникюрных салонов помните не только о своей безопасности, но и о безопасности других клиентов.

Кожные высыпания

Кожные высыпания, особенно на конечностях и туловище, часто является результатом приема рибавирина. Эта сыпь имеет тенденцию к появлению и исчезновению в период лечения.

Рекомендации:

  • Принимайте прохладную ванну, используйте увлажняющие мыла и лосьоны.
  • При сухости кожи, используйте шампунь, содержащий селен.
  • Защищайте Вашу кожу от солнечных лучей, которые могут усилить сыпь.
  • Избегайте приема горячего душа, ванны.
  • Если применение лосьонов и крема не улучшают состояния, посоветуйтесь с врачом.

Местные реакции в области инъекций

В местах инъекций возможно появление красноты и пятен. Ваше состояние улучшиться через несколько дней после окончания курса лечения.

Рекомендации
Если вы самостоятельно вводите препарат, соблюдайте правила введения лекарства.
Если вы испытываете боль, отек, раздражение в местах инъекций, проконсультируйтесь с врачом незамедлительно.

Советы для безопасных инъекций:
Мойте руки с мылом до проведения инъекций для предотвращения инфекции.
Убедитесь в том, что температура препарата соответсвует комнатной температуре.
Обработайте место введения, кожа должна быть сухой.
Постоянно меняйте места инъекций.
Не массируете место укола.
Прикладывайте холод к проблемным местам.
Посоветуйтесь со своим врачом об использовании крема с гидрокортизоном при зуде.
Одежда может раздражать кожу в местах укола, поэтомупрепочтительно носить одежду и белье из натуральных материалов. 
Иглы и шприцы не должны использоваться повторно.
Использование косметических кремов может помочь при незначительных раздражениях.

Боль в грудной клетке

Боль в грудной клетке довольно частый побочный эффект терапии. Вирус гепатита С влияет на весь организм – от мышц до суставов, легких и пищеварительной системы. Ваш пищевод, легкие, мышцы грудной клетки, ребра, сердце могут провоцировать различные симптомы в грудной клетке, они ощущаются как боль в груди. Но если боль появилась во время терапии, особенно если она значительна, отличается от боли, имевшейся ранее, или появляющейся во время подъема или спуска по лестнице, необходимо обратиться за медицинской помощью, т.к. возможно боль связана с проблемами сердечно-сосудистой системы и требует специальной терапии.

Рекомендации

Обратитесь за медицинской помощью, так как только доктор может решить, с чем связана Ваша проблема.

Одышка

Во время лечения многие пациенты замечают появление одышки. Это явление связано с уменьшением красных кровяных телец (анемией) на фоне приема рибавирина. При возникновении одышки немедленно обратитесь за медицинской помощью. Одышка может вызывать чувство страха. Врач поможет исключить бронхиальную астму или другое заболевание легких, требующее специального лечения.

Рекомендации

Обратите внимание, после чего появляется одышка, сообщите об этом своему врачу. Необходимо пройти дополнительные обследования, чтобы исключить заболевания сердца и легких.

Нарушения зрения

Нарушения зрения могут быть связаны с ухудшением ясности зрения. Если они возникают, Вам следует обратиться к врачу-окулисту, чтобы исключить другие причины ухудшения зрения.

Рекомендации
Посетите врача – офтальмолога до начала лечения, чтобы знать исходные показатели вашего зрения.
Опишите доктору время появления нарушений зрения, (ночь, при ярком свете, обычное время дня), как они проявляются (расплывчатость предметов, невозможность смотреть одним или двумя глазами, боль).
При заметных ухудшениях зрения (внезапное ухудшение зрения, внезапное изменение зрения одним глазом) обратитесь за медицинской помощью в течение 24 часов.

Проблемы, связанные со щитовидной железой

Щитовидная железа находиться на передней поверхности шеи и имеет размер абрикоса. Она контролирует многие функции организма: влияет на аппетит, вес, концентрацию. Пегиллированный интерферон может способствовать снижению и повышению активности функций щитовидной железы. Необходимо тщательно проверить функцию щитовидной железы перед лечением, а затем проверять ее каждые три месяца лечения. У большинства пациентов интерферон не вызывает нарушения функций щитовидной железы. При возникновении любых изменений, их следует обсудить с врачом.

Рекомендации

Расскажите своему врачу о тех изменениях, которые Вас тревожат, врач назначит Вам дополнительные исследования крови.

Анемия

Перед началом противовирусной терапии и в ходе лечения, необходимо регулярно, не реже одного раза в две недели, контролировать показатели общего анализа крови, включающего показатели эритроцитов, тромбоцитов и лейкоцитов.

Прием рибавирина часто приводит к анемии (понижению числа красных кровяных клеток), что приводит к хронической усталости и может вызывать боли в сердце, одышку или даже сердечный приступ. Анемия диагностируется с помощью двух тестов: определения количества гемоглобина и гематокрита.

Существуют два подхода к лечению рибавирин-индуцированной анемии: сокращение дозы рибавирина и использование эритропоэтина-бета, стимулирующего продукцию красных кровяных телец. Некоторые медицинские эксперты считают, что снижения дозы рибавирина следует избегать, особенно в течение первых 12 недель лечения, так как адекватные дозы рибавирина помогают предотвращению рецидивов и повышают шансы на достижение устойчивого вирусологического ответа (УВО).

Нейтропения

Основная функция лейкоцитов заключается в борьбе с инфекцией. Есть несколько типов белых кровяных клеток: нейтрофилы, лимфоциты, моноциты, эозинофилы и базофилы. Нейтропения характеризуется аномально низким количеством нейтрофилов. Нейтропения является широко распространенным побочным эффектом как обычных, так и пегилированных интерферонов. Клинические исследования показали, что у более чем 95% пациентов при противовирусной терапиипроисходило снижении количества нейтрофилов. У подавляющего большинства пациентов, у которых развивается интерферон — индуцированная нейтропения, не возникают серьезные инфекции. Однако, несмотря на это, очень важно, чтобы пациенты своевременно (не реже раза в 14 дней) контролировали показатели общего анализа крови с тем, чтобы предотвратить серьезные осложнения нейтропении. Нейтропения, как правило, корригируется уменьшением дозы

Источник: http://www.hvstop.org/page.php?id=22 

Генотипов ВГС — Группа действий по лечению

Февраль 2017

Что такое генотипы?

Генотип — это способ разделить вирус гепатита С (ВГС) на категории на основе схожих генов. Важно знать и понимать генотипы ВГС, потому что разные генотипы по-разному реагируют на лекарства, которые лечат и излечивают ВГС.

HCV имеет шесть генотипов, обозначенных с 1 по 6. Существуют также подтипы, обозначенные буквами, например, генотипы 1a и 1b.Большинство людей инфицированы одним доминантным генотипом, но одновременно может быть несколько (это называется смешанной инфекцией).

Почему генотип важен для лечения?

Знание своего генотипа ВГС — важная информация, которая может помочь пациентам и врачам найти наиболее эффективное лечение.

Все генотипы HCV вызывают одинаковое повреждение печени. Однако люди, инфицированные генотипом 1, особенно подтипом 1b, могут иметь больше шансов на развитие цирроза или тяжелого рубцевания печени, чем другие генотипы.Генотипы 1b и 3 могут повышать риск рака печени.

ВГС теперь можно вылечить с помощью всех пероральных противовирусных препаратов прямого действия (ПППД), которые предотвращают копирование вируса гепатита С. ПППД делают это, прилипая к белкам вируса и блокируя этапы жизненного цикла вируса. Это позволяет вашей иммунной системе вывести вирус из вашего тела. Насколько хорошо работает DAA, зависит от того, где он прикрепляется к целевым белкам вируса.

Некоторые из последних средств лечения DAA — это pangenotypic , что означает, что они могут вылечить все генотипы почти с одинаковой скоростью.

Почему у людей разные генотипы?

Человек любой расы или этнической группы может иметь любой генотип или подтип. Однако некоторые из них могут быть более распространены в одних расовых или этнических группах, чем другие. В Соединенных Штатах более 90% афроамериканцев по сравнению с 67% европеоидов имеют генотип 1.

Люди, которые путешествуют между регионами, где чаще встречаются разные генотипы, могут подвергаться воздействию разных генотипов ВГС, что приводит к смешанной инфекции .ВГС передается при контакте с кровью, например, через зараженные продукты крови или медицинское оборудование, при переливании крови, диализе почек или при совместном использовании оборудования для инъекций наркотиков, например шприцев, или неинъекционного оборудования, такого как трубки, ложки, ватные шарики или соломинки для нюхания наркотиков.

Меняются ли генотипы со временем?

Генотип вируса обычно не меняется. Генетические изменения или мутации могут происходить случайно или в ответ на окружающую среду.Некоторые мутации безвредны, но другие могут влиять на то, насколько хорошо пациент реагирует на лечение. Новые методы лечения ВГС включают более одного лекарства для предотвращения возникновения лекарственной устойчивости, воздействуя на более чем один этап жизненного цикла вируса. Однако, если пациенты пропускают лечебные дозы, это может привести к генетическим мутациям, которые вызывают устойчивость к лечению ВГС (см. Информационный бюллетень TAG о приверженности) .


ГЕНОТИП 3 ТРУДНО ЛЕЧИТЬ

Генотип 3 — второй по распространенности подтип ВГС в мире, особенно в Северной Европе, Южной Азии и Юго-Восточной Азии.Это может создать более серьезные проблемы со здоровьем для людей с ВГС, включая более быстрое прогрессирование заболевания печени, увеличение частоты стеатоза (неалкогольная жировая болезнь печени) и более высокий риск рака (гепатоцеллюлярная карцинома). Генотип 3 связан с уникальными характеристиками, такими как то, как он создает резистентность к инсулину и как он заставляет печень расщеплять жиры, что затрудняет лечение ПППД.

Людей, инфицированных генотипом 3, сложнее всего лечить, если они:

  • ранее лечились (имеют опыт лечения)
  • страдают циррозом печени, а
  • имеют декомпенсированное заболевание печени , которое представляет собой опасное для жизни состояние, ведущее к печеночной недостаточности.

Генотип 3 часто требует более длительного лечения и не обеспечивает высоких показателей излечения. У пациентов с циррозом печени показатели излечения ниже.


Какие тесты необходимы, чтобы узнать мой генотип?

При скрининге на ВГС пациент сдает несколько тестов для постановки диагноза (см. Информационный бюллетень Диагностика ВГС ).

После того, как пациенту поставили диагноз ВГС, врач проведет тесты на вирусную нагрузку и генотип перед началом лечения. Знание генотипа пациента определяет наилучшую схему лечения.

В генотипических тестах используется кровь, взятая из пальца или простого анализа крови. Пациенту может потребоваться вернуться в кабинет врача, чтобы подтвердить, является ли инфекция хронической, или подтвердить, что он излечился от вируса.

Генотипы 1a и 1b могут потребовать от пациента сдать дополнительные анализы крови, чтобы определить, обладает ли вирус какой-либо резистентностью (см. Информационный бюллетень Adherence ).

Лечение ВГС стало проще, безопаснее и эффективнее, а диагностика, включая генотипирование ВГС, должна стать проще и дешевле.

Лекарства доступны в зависимости от плательщика или того, что доступно в стране или регионе.

Какое лечение работает для каждого генотипа?

Рибавирин (рибавирин) вызывает врожденные дефекты и выкидыш. Схемы лечения ВГС, включающие рибавирин, не должны использоваться беременными женщинами или партнерами беременных женщин-мужчин. РБВ остается в организме человека в течение нескольких месяцев, поэтому женщинам и их партнерам-мужчинам следует избегать беременности в течение шести месяцев после ее прекращения (см. Информационный бюллетень о рибавирине).

Этот информационный бюллетень актуален по состоянию на декабрь 2016 года. Его рекомендуется читать вместе с информационными бюллетенями Adherence и HCV Diagnostics . Всегда проверяйте наличие обновленной информации.

Zepatier в вирусе гепатита С генотипа 1a | CATIE

Существует несколько штаммов или генотипов вируса гепатита С (ВГС): генотипы с 1 по 6. Эти генотипы можно разделить на подгруппы, такие как генотип 1a, 1b и так далее.

В Канаде, Австралии, США.S., Великобритания, Бразилия и Скандинавия, генотип 1 является обычным, а генотип 1a встречается чаще, чем генотип 1b. Более того, генотип 1a имеет тенденцию меньше реагировать на терапию, чем 1b.

Исследователи из нескольких стран, а также фармацевтическая компания Merck (известная как MSD за пределами Северной Америки) объединили данные исследований фазы II и фазы III Zepatier (комбинация фиксированных доз элбасвира и гразопревира), принимаемых с широким спектром действия или без него. -спектральный противовирусный препарат рибавирин у людей с генотипом 1а ВГС.Затем они просмотрели эти данные.

Ключевые выводы обзора следующие:

При приеме один раз в день в течение 12 недель подряд Zepatier высокоэффективен у пациентов с генотипом 1a, которые ранее не лечились или которые ранее лечились и у которых возник рецидив.

Зепатье + рибавирин, принимаемый в течение 16–18 недель, очень эффективен у пациентов с генотипом 1а, у которых был вирусологический отказ от предыдущего лечения.

Эффективность Zepatier была одинаковой у участников независимо от того, был ли у них цирроз (обширное рубцевание печени).

Подробнее об исследовании

Исследователи проанализировали данные 893 участников, распределенных следующим образом:

  • ранее не лечили ВГС — 550 человек
  • ранее лечились, но впоследствии рецидивировали — 343 человека

Средний профиль участников в начале исследования был следующим:

  • 70% мужчин, 30% женщин
  • 92% были моложе 65 лет
  • основные этно-расовые группы — 75% белых, 20% черных
  • большинство (70%) участников не имели цирроза печени
  • у большинства (80%) участников вирусная нагрузка ВГС составляла 6 миллионов МЕ / мл или меньше

Среди участников, прошедших лечение, 76% ранее испытали вирусологическую неудачу, а у остальных 24% возник рецидив.

Результат

Эффективность Zepatier была высокой, от 90% до 100% излечения. Излечение также может быть выражено в виде устойчивого вирусологического ответа (УВО) через 12 или 24 недели после окончания курса лечения, записанного как УВО 12 или УВО 24 .

Вот показатели излечения для разных групп участников:

Без предварительной обработки

  • Zepatier в течение 12 недель — 95% участников вылечились (402 из 426 человек)
  • Зепатье + рибавирин в течение 12 недель — 95% участников вылечились (71 из 77 человек)
  • Zepatier от 16 до 18 недель — 91% участников вылечились (21 человек из 23)
  • Зепатье + рибавирин от 16 до 18 недель — вылечились 100% участников (23 из 23 человек)

Предыдущий рецидив

Люди из этой группы ранее получали лечение (интерфероном и / или рибавирином).Хотя это предшествующее лечение позволило значительно снизить количество ВГС в их крови, после окончания курса лечения уровень ВГС в их крови резко вырос. Вот распределение излечения в этой группе участников по режимам:

  • Zepatier на 12 недель — 100% излечение (22 из 22 человек)
  • Зепатье + рибавирин в течение 12 недель — излечение 96% (25 из 26 человек)
  • Zepatier на срок от 16 до 18 недель — 92% излеченных (12 из 13 человек)
  • Зепатье + рибавирин в течение 16-18 недель — 100% излечение (21 человек из 21)

Предыдущие неудачные попытки лечения

В этой категории люди ранее получали лечение, но количество HCV в их крови не было значительно снижено.Доли участников, добившихся излечения по схеме, были следующими:

  • Zepatier за 12 недель — 90% вылечили (62 из 69 человек)
  • Зепатье + рибавирин в течение 12 недель — излечение 94% (75 из 80 человек)
  • Zepatier на срок от 16 до 18 недель — 94% излеченных (49 из 52 человек)
  • Зепатье + рибавирин в течение 16-18 недель — 100% излечение (54 из 54 человек)

Цирроз

Люди с обширным поражением печени из-за ВГС обычно не реагируют на лечение так же хорошо, как люди без цирроза.

В целом, вот результаты лечения Зепатье в течение 12 недель (с рибавирином или без него), в зависимости от статуса цирроза, у участников, которые ранее не лечились или уже лечились и испытали рецидив:

  • цирроза нет — вылечено 95% (345 из 362 человек)
  • цирроз печени — 98% вылечено (79 из 81 человек)

Вот результаты среди участников, у которых предыдущая терапия ВГС оказалась неэффективной и которые получали Зепатье с рибавирином или без него в течение 16–18 недель:

  • цирроза нет — 100% излечены (31 человек из 31)
  • цирроз печени — 100% вылечено (23 из 23 человек)

Сопротивление

У некоторых участников был ВГС, который был в некоторой степени устойчив к исследуемым препаратам.Устойчивость может развиться из-за того, что клетки, инфицированные вирусом гепатита C, производят большое количество вируса, и иногда некоторые из этих вирусов имеют изменения (или мутации), которые происходят случайно. Некоторые из этих мутаций могут помочь HCV частично или полностью сопротивляться эффекту лечения. Устойчивость также могла развиться, если бы некоторые участники в прошлом проходили терапию, которая была похожа по структуре или форме на лекарства в Zepatier, и такая предыдущая терапия потерпела неудачу.

Резистентность и рецидив лечения в прошлом

При анализе образцов крови подгруппы участников, вот как распределялись мутации, связанные с устойчивостью к лечению, и результат терапии Зепатье:

  • мутаций устойчивости нет — 98% вылечили (284 из 289 человек)
  • наличие мутаций устойчивости — 91% вылечили (136 из 150 человек)

Сопротивление и неэффективность лечения в прошлом

Среди участников, у которых случился рецидив при предыдущем лечении и которые получали Зепатье + рибавирин в течение 16-18 недель, вот показатели излечения, распределенные по наличию мутаций устойчивости в начале исследования:

  • отсутствие мутаций устойчивости — 100% вылечено (38 из 38 человек)
  • наличие мутаций устойчивости — 100% вылечены (14 из 14 человек)

Примечание колодец

Настоящий анализ показал, что в целом 12-недельный курс Зепатье с рибавирином или без него очень эффективен среди не лечившихся участников с трудно поддающимся лечению штаммом ВГС, называемым генотипом 1а.

Более длинные схемы — 16 недель — были одобрены регулирующими органами Канады и США для использования пациентами с генотипом 1, которые ранее испытывали вирусологическую неудачу при использовании других схем.

Анализы безопасности Zepatier представлены в других отчетах этого выпуска TreatmentUpdate .

—Шон Р. Хосейн

СПРАВКА:

Thompson A, Zeuzem S, Rockstroh J, et al. Комбинация эльбасвира и гразопревира очень эффективна для лечения пациентов, инфицированных генотипом 1а. Американская ассоциация по изучению заболеваний печени , 13-17 ноября 2015 г. Аннотация 703.

Генотипов гепатита С | Hepatitis C Trust

Какой генотип гепатита C у кого-то есть, определяет, какое лечение ему доступно. Если вы живете с генотипом 3, то есть свидетельства того, что заболевание печени может прогрессировать быстрее.

Способность вируса к мутации привела к существованию различных генетических вариаций HCV. Это так называемые генотипы. Различные генотипы часто, но не исключительно, связаны с разными частями мира.

Генотипы 1, 2 и 3 распространены по всему миру. Типы 1a и 1b являются наиболее распространенными, на их долю приходится около 60% глобальных инфекций. Они преобладают в Северной Европе и Северной Америке, а также в Южной и Восточной Европе и Японии. Генотип 2 представлен реже, чем тип 1. Генотип 3 является эндемиком Юго-Восточной Азии. Генотип 4 в основном встречается на Ближнем Востоке, в Египте и Центральной Африке.Тип 5 встречается почти исключительно в Южной Африке. В Великобритании наиболее распространены генотипы 1 и 3.

До сих пор неясно, влияет ли тип вируса на прогрессирование заболевания. Если это так, не предполагается, что это действительно повод для беспокойства. Однако генотип ВГС влияет на реакцию на лечение. Если вы подумываете о лечении, очень важно знать, каким генотипом (а в идеале — подтипом) вы действительно инфицированы.

Каждый генотип также содержит ряд незначительных вариаций. Они известны как «подтипы». Они пронумерованы a, b, c, d и т. Д. В порядке их открытия. У человека, хронически инфицированного гепатитом С, будет вирусная популяция, состоящая из очень большого количества этих незначительных генетических вариаций. Они называются «квазивидами» и представляют собой еще более сложную проблему для иммунной системы.

HCV также описывается как имеющий геномы с положительной одноцепочечной РНК. Это означает, что каждая вирусная частица содержит одну цепь РНК.В пределах HCV РНК выполняет две функции. Во-первых, он содержит информацию о генетике ВГС. Во-вторых, он также содержит информацию о том, как производить белки, необходимые вирусу для репликации, как из его собственных компонентов, так и из компонентов клетки печени хозяина.

Рентабельность новых противовирусных препаратов для лечения гепатита С, не являющегося генотипом 1, в Китае: социальная перспектива

Ключевые вопросы

Что уже известно?
  • Противовирусные препараты прямого действия (ПППД) значительно повысили эффективность и снизили бремя нежелательных явлений, что сделало возможным искоренение вируса гепатита С (ВГС) во всем мире.

  • Международные и национальные исследования доказали экономическую эффективность некоторых ПППД по сравнению с пегилированным интерфероном и рибавирином (ПЭГ-рибавирин) для пациентов с генотипом 1 с точки зрения плательщика.

Какие новые выводы?
  • Это исследование было направлено на оценку экономической эффективности всех ПППД по сравнению с PEG-RBV для пациентов с негенотипом 1 с социальной точки зрения в китайских условиях.

  • Это была первая оценка для количественного сравнения пангенотипического режима софосбувир / велпатасвир (SOF / VEL) с другими ПППД или PEG-RBV, особенно для пациентов с негенотипом 1 в Китае, учитывая ограниченный доступ к генетическому тестированию в слаборазвитых регионах .

  • Анализ пороговых значений использовался для расчета разумных цен на различные ПППД для достижения большей экономической эффективности по сравнению с оптимальным режимом лечения ПППД для каждого генотипа.

Что означают новые результаты?
  • Для пациентов с негенотипом 1 в Китае ПППД были более рентабельными, чем PEG-RBV, и обеспечивали лучшие результаты для здоровья и более высокое качество жизни.

  • Что еще более важно, разумное снижение цен на ПППД повысит доступность лекарств и имеет большое значение для глобальной стратегии искоренения вирусного гепатита, особенно для пангенотипического режима SOF / VEL, который может упростить клинический путь распространения ВГС инфекционное заболевание.

Введение

Инфекция, вызванная вирусом гепатита С (ВГС), стала глобальной проблемой общественного здравоохранения, и соответствующие долгосрочные осложнения, такие как цирроз печени или гепатоцеллюлярная карцинома, стали тяжелым бременем для здоровья и экономики пациентов. В мире насчитывается около 71 миллиона пациентов, инфицированных ВГС, что приводит к примерно 399 000 смертей ежегодно.1 В Китае заболеваемость ВГС резко возросла за последнее десятилетие, и расчетное число пациентов достигло 9. 8 миллионов в 2015 году.1 Однако в тот же период уровень диагностики составлял всего 2%, а уровень лечения — менее 1% в Китае, что намного ниже среднемирового показателя.2 3 Цирроз печени и гепатоцеллюлярная карцинома являются основными причинами смерти от ВГС. Смертность от цирроза печени, вызванного ВГС, в Китае составляла 0,2 на 100000 человек, а от гепатоцеллюлярной карциномы — 0,4 на 100000 человек в 2016 году.4

Основная цель лечения инфекции ВГС — достижение устойчивого вирусологического ответа (УВО), которые могут значительно снизить риск прогрессирования цирроза печени или гепатоцеллюлярной карциномы.5 Пегилированный интерферон плюс рибавирин (ПЭГ-рибавирин) был стандартом лечения в Китае до введения противовирусных препаратов прямого действия (ПППД) в 2017 г. 6 По сравнению с субоптимальной эффективностью и тяжелыми побочными эффектами ПЭГ-рибавирина, ПППД резко снизили заболеваемость и смертность, связанная с инфекцией ВГС. Тем не менее, пациенты по-прежнему имеют ограниченный доступ к таким методам лечения в Китае, поскольку некоторые ПППД, такие как асунапревир, даклатасвир, софосбувир, софосбувир / ледипасвир, элбасвир / гразопревир и софосбувир / велпатасвир (SOF / VEL), не были одобрены в рамках процедуры приоритетного рассмотрения до 2017 г. .Кроме того, ПППД были более дорогостоящими, чем традиционная терапия PEG-RBV, и PEG-RBV был единственным препаратом в национальном списке возмещения расходов на лекарства до конца 2019 года.

Хотя наиболее распространенным генотипом HCV в Китае является генотип 1, пациенты с Негенотип 1 по-прежнему составляет 43,2% .6 В отличие от различных вариантов лечения пациентов с генотипом 1, их можно лечить только ограниченными типами ПППД. Среди этих пациентов генотипы 2 (15,8%), 3 (8,7%) и 6 (5,7%) составляют большинство, а также генотипы 4 и 5, о которых почти не сообщалось.6 7 Существуют значительные региональные различия в распределении генотипов. Генотипы 2 и 3 более распространены в западном Китае, а генотип 6 более распространен в южном Китае6.

В настоящее время имеются скудные доказательства экономической эффективности ПППД для пациентов с негенотипом 1. Следовательно, это исследование была направлена ​​на оценку экономической эффективности всех схем лечения для пациентов с негенотипом 1 и предоставление информации для искоренения вирусного гепатита в Китае и во всем мире.

Методы

Структура модели и допущения

Марковская модель для анализа решений была разработана на основе результатов предыдущих исследований. 8–10 Были рассмотрены пятнадцать исключительных состояний здоровья, как показано на рисунке 1. Состояния фиброза печени по методу METAVIR (F0— нет фиброза, F1 — портальный фиброз без перегородок, F2 — портальный фиброз с небольшим количеством перегородок, F3 — многочисленные перегородки без цирроза и F4 — компенсированный цирроз), состояния фиброза печени, достигающие УВО (SVR F0 – F4), декомпенсированный цирроз (DC), гепатоцеллюлярный карцинома (HCC), трансплантация печени (LT), посттрансплантация печени (PLT) и смерть.Модель включала этапы лечения и прогрессирования заболевания. При входе в модель пациенты получали разные схемы лечения. Последующие стадии определялись в соответствии с их исходным состоянием здоровья и результатами лечения. Были приняты годовые циклы и срок службы. Ключевые предположения исследования были следующими11–14: (1) спонтанная элиминация вируса не рассматривалась; (2) пациенты получали лечение только один раз, без рассмотрения дальнейшего лечения после неэффективности лечения или рецидива; (3) соблюдение режима лечения было 100%; (4) пациенты в состояниях F0 – F3 больше не будут испытывать прогрессирования заболевания после достижения УВО, тогда как пациенты в состоянии F4 с УВО и все пациенты без УВО войдут в стадию прогрессирования заболевания.

Рисунок 1

Структура аналитической модели Маркова. ПППД, противовирусные препараты прямого действия; ДК, декомпенсированный цирроз печени; F0 – F4, состояния фиброза METAVIR; ГЦК, гепатоцеллюлярная карцинома; LT — трансплантация печени; Не УВО, отсутствие устойчивого вирусологического ответа; ПЭГ-РБВ, пегилированный интерферон плюс рибавирин; PLT, после трансплантации печени; УВО — устойчивый вирусологический ответ; УВО F0 – F3, пациент в состояниях F0 – F3, достигший УВО; УВО F4, пациент в состоянии F4, достигший УВО.

Характеристики пациентов

Целевой группой были пациенты, не получавшие лечения, инфицированные генотипами 2, 3 и 6 ВГС.Модель проследила гипотетическую когорту из 10 000 пациентов для каждого из трех генотипов. Исходные характеристики были получены в результате поперечного обсервационного исследования в Китае 7, где средний возраст пациентов, инфицированных генотипами 2, 3 и 6, составлял 48, 38 и 35 лет соответственно. Таким образом, в исследовании предполагалось, что пациенты вошли в модель в возрасте 50, 40 и 35 лет для генотипов 2, 3 и 6 соответственно. По данным того же исследования, доля мужчин составила 50,80%, 75,80% и 66 человек.70% для пациентов, инфицированных генотипами 2, 3 и 6, соответственно.7 Согласно другому китайскому исследованию, в котором наблюдались пациенты с HCV в течение 20 лет, исходное распределение состояний фиброза METAVIR составляло 0,80% (F0), 45,50% (F1 ), 41,30% (F2), 9,90% (F3) и 2,50% (F4) соответственно.15

Схемы лечения и клинические данные

Схемы лечения для каждого генотипа были определены в соответствии с текущими клиническими руководящими принципами и предлагаемыми показаниями для применения ПППД в Китае .6 Для пациентов, инфицированных генотипом 2 ВГС, были оценены четыре схемы лечения: ПЭГ-рибавир в течение 24 недель и софосбувир плюс рибавирин (SOF-RBV), софосбувир плюсдаклатасвир (SOF-DCV) и SOF / VEL в течение 12 недель.Для генотипа 3 рассматривались PEG-RBV и SOF-RBV в течение 24 недель, а также SOF-DCV и SOF / VEL в течение 12 недель. Для генотипа 6 рассматривались PEG-RBV в течение 48 недель и SOF-RBV, SOF-DCV и SOF / VEL в течение 12 недель. Первичным показателем эффективности в модели был УВО, определяемый как неопределяемый уровень РНК ВГС через 12 недель после окончания лечения6.

Доступные схемы лечения и соответствующий УВО для пациентов без цирроза печени (F0 – F3) и пациентов с цирроз печени (F4) был представлен в дополнительной онлайн-таблице 1.УВО для PEG-RBV и SOF-DCV были получены на основе систематических обзоров или метаанализа. 16–22 УВО для SOF-RBV и SOF / VEL были получены на основе трех опубликованных клинических испытаний в азиатских или китайских условиях21–23. из-за ограниченной доступности данных УВО для пациентов с циррозом печени, инфицированных генотипом 6, был назначен так же, как и для пациентов без цирроза.

Вероятности перехода

Поскольку эпидемиологические исследования с большой выборкой в ​​Китае проводятся редко, в этом исследовании использовались вероятности перехода из других стран.Вероятности перехода считались сопоставимыми для трех генотипов14. 24–26. Вероятности прогрессирования фиброза печени между состояниями F0 и F4 были получены из метаанализа с использованием оценки максимального правдоподобия Маркова. 27 Пациенты в состоянии F4 могли прогрессировать до DC и HCC, и соответствующие вероятности были получены из Dienstag et al .28 Пациенты с DC также испытали переход к HCC.28 Только пациенты с DC и HCC могли получить трансплантат печени, и соответствующие вероятности были получены из Townsend et al 29 и Planas et al. 30 После достижения УВО пациенты в состоянии F4 могут прогрессировать до поздней стадии заболевания печени, но обычно имеют более низкий риск, чем те, у кого не достигнут УВО. Коэффициенты смертности, связанные с DC, HCC, LT и PLT, превышающие общую смертность, были получены из литературы.31–34 Повозрастные коэффициенты смертности от всех причин были извлечены из таблиц дожития в странах-членах ВОЗ35. Предполагалось, что пациенты F0 – F3 после достижения УВО имели такие же показатели смертности, как и население в целом.Пациенты с F4, достигшие УВО, и пациенты с F0 – F4, которые не достигли УВО, имели в 1,436 и 2,3737 раз больше фоновой смертности, соответственно. Коэффициенты смертности для пациентов старше 65 лет не корректировались из-за значительно более высокой общей смертности.

Затраты

В этом исследовании была принята социальная перспектива. Все затраты были пересчитаны в доллары США с использованием официального обменного курса 2018 года (1 доллар США = 6,62 фунта стерлингов) и увеличены до цен 2018 года с использованием индекса потребительских цен Китая. Все затраты были перечислены в дополнительной онлайн-таблице 1.

Прямые медицинские расходы состояли из затрат на лекарства, мониторинг и ежегодные расходы на состояние здоровья печени. Стоимость лекарств зависела от схемы, с разными ценами на лекарства и продолжительностью лечения. Кроме того, цены на лекарства были получены из местной базы данных38, в которой указаны цены на лекарства в каждой провинции Китая. В связи с принятой социальной точкой зрения, в этом исследовании использовались медианные цены в разных провинциях, оплачиваемые только пациентами или пациентами и плательщиками, вместе с возмещением стоимости лекарств. Согласно последним руководящим принципам в отношении инфекции ВГС в Китае, 6 пациентов должны пройти генотипирование и тесты на фиброз печени для оценки тяжести заболевания печени перед лечением, а также регулярное наблюдение для контроля эффективности и безопасности лечения во время лечения. Регулярное наблюдение проводилось каждые 3 месяца во время лечения, включая, среди прочего, РНК ВГС в плазме, общий анализ крови и УЗИ печени; Количество тестов пациентов варьировалось в зависимости от продолжительности лечения.На основании местных сборов за тесты и консультации со специалистами по ВГС стоимость генотипирования, теста на фиброз печени и планового наблюдения была установлена ​​в размере 63 долларов США, 21 доллара США и 302 доллара США соответственно. Годовые затраты на состояние здоровья печени, связанные с F0 – F4, DC и HCC, были получены из исследования, проведенного в основных больницах в восьми городах материкового Китая39. Для LT и PLT затраты были получены из исследования бремени болезней при трансплантации печени в Китае. Пациенты. 40 Пациенты в состояниях F0 – F3 с УВО больше не будут нести прямые медицинские расходы, а пациенты в состоянии F4 с УВО меньше нуждаются в ресурсах здравоохранения, 0.В 709 раз больше пациентов в состоянии F4 без УВО.41

Из-за ограниченных исследований прямых немедицинских и косвенных затрат пациентов с ВГС в Китае, данные по этим аспектам были получены в результате опроса пациентов, проведенного в Тяньцзине для централизованных и стандартизированных пациентов. управление. Взрослые пациенты с HCV, получавшие PEG-RBV или DAA в последние несколько лет, были приглашены по телефону для участия в опросе. Всего в 2018–2019 гг. Были обследованы 155 пациентов, получавших PEG-RBV, и 145 пациентов, получавших ПППД.Исходя из характеристик лечения ВГС, прямыми немедицинскими затратами были расходы на транспортировку и питание пациентов и членов их семей, а косвенными затратами было снижение производительности пациентов и членов их семей. Подход, основанный на человеческом капитале, использовался для расчета потерь производительности на основе потерянного рабочего времени и располагаемого дохода на душу населения в Китае в 2018 году. В сочетании с продолжительностью лечения были рассчитаны прямые немедицинские затраты и косвенные затраты для каждой схемы.

Входные данные для коммунальных предприятий

Входные данные для коммунальных предприятий состояли из трех частей, как показано в дополнительной онлайн-таблице 1. Поскольку китайские значения коммунальных услуг не были доступны, в этом исследовании использовались данные из международной литературы. Значения полезности хронических состояний ВГС были получены из систематических обзоров качества жизни пациентов с ВГС.42 43 Пациенты будут испытывать снижение полезности во время лечения из-за связанных с лечением побочных эффектов, причем полезность снижается на 0,11 при использовании PEG-RBV и 0.03 при лечении ПППД.44 Значения полезности после достижения SVR для состояний F0 – F4 были получены из Wright et al. 45

Анализ модели

Предлагаемая модель была разработана в программе Microsoft Excel 2016 (Microsoft). Будущие затраты и QALY были дисконтированы по годовой ставке 5 %. 46 Готовность платить была установлена ​​на уровне 9769 долларов США / QALY, что соответствует пороговому значению, равному разовому ВВП на душу населения в 2018 году в Китае. Затраты на срок службы, количество лет жизни с поправкой на качество (QALY) и коэффициенты дополнительной экономической эффективности (ICER) были проиллюстрированы как границы эффективности.

Односторонний анализ чувствительности был проведен для оценки влияния изменений отдельных параметров на результаты модели. Затраты, SVR, вероятности перехода, коммунальные услуги и ставка дисконтирования были протестированы в диапазоне, указанном в таблице исходных данных. 95% доверительный интервал каждого параметра использовался в качестве нижнего и верхнего значений для одностороннего анализа чувствительности. В случае, если 95% доверительный интервал отсутствовал, параметр изменялся на ± 25%. Кроме того, ставка дисконтирования составляла от 0% до 8%. Результаты были представлены в виде диаграмм торнадо.

Моделирование Монте-Карло было выполнено в рамках вероятностного анализа чувствительности для проверки устойчивости результатов модели, когда все параметры изменялись одновременно. Всего было выполнено 1000 итераций Монте-Карло путем многократной выборки из распределений, назначенных всем неопределенным параметрам (гамма-распределение для затрат и бета-или равномерное распределение для SVR, коммунальных услуг и вероятностей перехода). Результаты были представлены в виде кривых приемлемости затрат и эффективности, которые отражали вероятность того, что схемы лечения будут экономически эффективными при различных порогах готовности платить.

Кроме того, был проведен пороговый анализ для повышения доступности для пациентов. Сохраняя все остальные параметры постоянными, в исследовании была оценена пороговая цена, при которой схема лечения показывала равную экономическую эффективность по сравнению с оптимальной схемой DAA для каждого генотипа.

Участие пациентов и общественности

В этом исследовании не было прямого участия пациентов и общественности.

Результаты

Анализ базового случая

Результаты базового случая были представлены в таблице 1 и на рисунке 2. Для пациентов, инфицированных генотипом 2 ВГС, ПППД увеличили QALY по сравнению с PEG-RBV, но с более высокими затратами. Граница эффективности состояла из PEG-RBV и SOF / VEL. SOF-RBV и SOF-DCV были выше границы эффективности из-за более низкой эффективности или более высоких затрат. ICER для SOF / VEL, SOF-RBV и SOF-DCV по сравнению с PEG-RBV составляли 5653 долларов США, 7999 долларов США и 10 680 долларов США за QALY, соответственно. SOF / VEL был наиболее экономически эффективным режимом и снизил наибольшую совокупную вероятность DC и HCC на 4,29% и 3.22% соответственно. Результаты были аналогичными для генотипа 3. SOF-DCV был наиболее экономически эффективным режимом с ICER 3314 долларов США / QALY, что снизило совокупную вероятность DC и HCC на 8,09% и 6,26% соответственно. Три схемы ПППД для генотипа 6 были экономичными; SOF-RBV был наиболее экономичным подходом из-за его выдающихся преимуществ для здоровья.

Таблица 1

Экономическая эффективность различных схем в условиях Китая

Рисунок 2

Границы эффективности различных схем для трех генотипов. ПЭГ-РБВ, пегилированный интерферон плюс рибавирин; SOF-DCV, софосбувир плюс даклатасвир; СОФ-РБВ, софосбувир плюс рибавирин; СОФ / ВЭЛ, софосбувир / велпатасвир; QALY, годы жизни с поправкой на качество.

Анализ чувствительности

При одностороннем анализе чувствительности для каждого генотипа был проанализирован наиболее экономически эффективный режим по сравнению с PEG-RBV. Диаграммы торнадо 10 наиболее чувствительных параметров показаны на рисунке 3. ICER были наиболее чувствительны к полезности пациентов в состояниях F0 – F3 после достижения УВО, в то время как другие факторы, включая ставку дисконтирования, стоимость лекарств и УВО, были наиболее чувствительны. немного отличается.Для генотипов 2 и 3 корректировка некоторых параметров, таких как учетная ставка, может сделать оптимальный режим более не рентабельным. Для генотипа 6 изменения параметров не оказали принципиального влияния на результаты базового случая.

Рисунок 3

Диаграммы «Торнадо» оптимального режима по сравнению с PEG-RBV для трех генотипов. ПППД, противовирусные препараты прямого действия; F0 – F4, состояния фиброза METAVIR; ПЭГ-РБВ, пегилированный интерферон плюс рибавирин; УВО — устойчивый вирусологический ответ; SOF-DCV, софосбувир плюс даклатасвир; СОФ-РБВ, софосбувир плюс рибавирин; СОФ / ВЭЛ, софосбувир / велпатасвир.

В анализе вероятностной чувствительности также использовался наиболее экономичный режим для сравнения. Кривые приемлемости затрат и эффективности показали, что ниже порогового значения 9769 долларов США / QALY вероятность того, что SOF / VEL, SOF-DCV и SOF-RBV будут рентабельными, составляла 58%, 83% и 71% для генотипов 2, 3 и 6 соответственно, как показано на рисунке 4. Если пороговое значение было увеличено до трехкратного значения китайского ВВП на душу населения (29 307 долларов США), соответствующая вероятность увеличилась бы до 86%, 93% и 72% соответственно.

Рисунок 4

Кривая приемлемости затрат-эффективности для трех генотипов. ВВП, валовой внутренний продукт; ПЭГ-РБВ, пегилированный интерферон плюс рибавирин; QALY — год жизни с поправкой на качество; SOF-DCV, софосбувир плюс даклатасвир; СОФ-РБВ, софосбувир плюс рибавирин; СОФ / ВЭЛ, софосбувир / велпатасвир.

Пороговый анализ

Мы выбрали оптимальный режим DAA для сравнения в пороговом анализе для каждого генотипа. Для генотипа 2 снижение цен на софосбувир и даклатасвир, необходимое для достижения той же экономической эффективности, что и оптимальная схема SOF / VEL, составило 8% и 41% соответственно.Чтобы добиться экономии затрат на все схемы для генотипа 2, софосбувир, даклатасвир и SOF / VEL нуждаются в снижении цен на 28%, 63% и 25% соответственно. Для генотипа 3 снижение цен на софосбувир и SOF / VEL должно составлять 31% и 10% соответственно по сравнению с оптимальным режимом SOF-DCV. Для дальнейшего снижения затрат на софосбувир и SOF / VEL необходимо снизить цену на 45% и 25% соответственно. Поскольку все схемы для генотипа 6 были экономичными, софосбувир, даклатасвир и SOF / VEL должны снизить свою цену на 31%, 31% и 20% для достижения такой же экономической эффективности, как SOF-RBV.Результаты порогового анализа представлены в таблице 2.

Таблица 2

Результаты порогового анализа для трех генотипов

Обсуждение

В нескольких исследованиях изучалась экономическая эффективность схем лечения для пациентов, инфицированных ВГС негенотипа 1, особенно генотипа 6, в Китай. 47 48 В этом исследовании оценивалась экономическая эффективность всех доступных ПППД и PEG-RBV для пациентов, инфицированных генотипами 2, 3 и 6 в Китае. Результаты базового случая показали, что SOF / VEL и SOF-RBV были более рентабельными, чем PEG-RBV, в то время как ICER для SOF-DCV превышал порог готовности платить для генотипа 2.Для генотипа 3 SOF-DCV и SOF / VEL были более рентабельными, чем PEG-RBV, тогда как SOF-RBV не был рентабельным. SOF-RBV, SOF / VEL и SOF-DCV все были экономически доминирующими по сравнению с PEG-RBV для генотипа 6, поскольку продолжительность лечения генотипов 2 и 3 с помощью PEG-RBV была только вдвое меньше, чем у генотипа 6. Анализ чувствительности показал, что результаты базового случая были надежными. Что еще более важно, цены на препараты ПППД необходимо снизить на 8–63% по сравнению с наиболее рентабельной схемой лечения ПППД для каждого генотипа.

В Китае было проведено несколько анализов экономической эффективности. Однако большинство исследований было сосредоточено на пациентах, инфицированных HCV генотипа 1. 11 39 49 Среди этих исследований Chen H et al. 11 и Chen GF et al 39 сравнивали DAA с PEG-RBV для генотипа 1; однако их результаты могут иметь потенциальные ограничения в условиях Китая, поскольку информация о стоимости лекарств была получена из других стран (ПППД в то время не были доступны в Китае). В другом исследовании оценивали пангенотипический SOF / VEL с другими DAA, показывая, что более низкая цена SOF / VEL сделает его более рентабельным; однако общие результаты этого исследования были ограничены, поскольку рассматривался только генотип 1.49 Wu и др. — единственные исследователи, которые оценили экономическую эффективность SOF-RBV и SOF-DCV для китайских пациентов с негенотипом 1, показав, что SOF-RBV был рентабельной альтернативой для генотипов 2 и 3 и экономичная альтернатива для генотипа 6 по сравнению с PEG-RBV.14 Однако пангенотипический SOF / VEL, упрощающий лечение, не был включен в их исследование. Насколько известно авторам, ни одно исследование экономической эффективности не включало все доступные ПППД для лечения пациентов с негенотипом 1 в Китае. Следовательно, это исследование, вероятно, станет первой экономической оценкой в ​​этой области.

Социальная перспектива была принята в нескольких исследованиях, проведенных в основном в США. В двух американских исследованиях сравнивалась экономическая эффективность ПППД, ПППД плюс ПЭГ-рибавирин и ПЭГ-рибавирин с использованием аналогичной модели Маркова50. 51 Результаты показали, что лечение на основе СОФ было рентабельным, но при этом следовало учитывать доступность. Однако были включены только затраты, связанные с лекарствами и заболеваниями печени, и только пациенты с генотипом 1 были включены.Другое исследование, оценивающее схемы лечения ПППД с ПЭГ-рибавирином, показало, что новые методы лечения были экономически эффективными по сравнению со стандартным лечением для генотипа 1 и, вероятно, для генотипа 3, но не для пациентов с генотипом 2 в американских условиях.25 Аналогичным образом были включены только прямые медицинские расходы. , в то время как косвенные затраты, связанные с потерей производительности или немедицинскими затратами, не рассчитывались. Когда были включены затраты на прогулы, присутствие на работе и время пациента / опекуна, в другом американском исследовании было обнаружено, что ПППД экономят затраты по сравнению с отсутствием лечения.52 SOF-RBV оказался рентабельным по сравнению с PEG-RBV у пациентов с генотипом 2, с учетом стоимости потери продуктивности в японском сценарии 53, что соответствует нашим результатам.

ПППД предлагают пациентам более эффективные, более короткие и лучше переносимые варианты лечения; следовательно, необходимо сравнение ПППД. По сравнению с оптимальной схемой DAA для каждого генотипа, другие DAA нуждаются в снижении цен для достижения такой же экономической эффективности. Поскольку использование SOF / VEL создает возможность упростить путь лечения, устраняя необходимость в генотипировании, можно сэкономить дополнительные прямые немедицинские затраты, такие как транспортные расходы.49 Этот аспект особенно важен для учреждений первичной медико-санитарной помощи, где тесты на генотипирование недоступны для лечения пациентов с ВГС. В этом исследовании было обнаружено, что SOF / VEL является рентабельным для всех генотипов, в то время как для него требовалось снижение цены на 10% и 20% по сравнению с SOF-DCV в генотипе 2 и SOF-RBV в генотипе 6 соответственно.

Настоящий анализ имеет несколько ограничений. Во-первых, некоторые показатели УВО были получены в результате отдельных клинических испытаний из-за нехватки прямых испытаний, сравнивающих эти схемы лечения, что может привести к необъективным результатам.Во-вторых, вероятности перехода были получены из международных исследований при отсутствии внутренних источников информации. В будущих исследованиях следует обновить анализ, когда эти данные станут доступны в Китае. В-третьих, значения полезности из других стран были отнесены к состояниям здоровья из-за недоступности данных о коммунальных услугах для Китая, что может повлиять на точность наших результатов. Кроме того, необходимо увеличить размер выборки для нашего опроса пациентов, чтобы сделать прямые немедицинские и косвенные затраты более общими. Наконец, наши результаты могут отличаться от окончательных дисконтированных цен после переговоров о ценах в 2019 году, поскольку стоимость лекарств была получена на основе рыночных цен, и некоторые недавно утвержденные схемы, такие как глекапревир / пибрентасвир, следует рассмотреть в будущем.

Заключение

ПППД были экономически эффективными по сравнению с традиционными методами лечения китайских пациентов с ВГС не генотипа 1, но ICER DAA были другими. Чтобы полностью искоренить вирусный гепатит к 2030 году, цены на ПППД необходимо снизить до некоторой степени, чтобы повысить экономическую эффективность и доступность этих лекарств, особенно в развивающихся странах.

Пегинтерферон и рибавирин, с телапревиром или без него, для гепатита C генотипа 1 и полиморфизма CC IL28B — полный текст

Хроническая инфекция вирусом гепатита C (HCV), которым страдают 1-2% взрослых в США, является основным фактором риска печеночной недостаточности из-за цирроза и / или гепатоцеллюлярной карциномы (Davis 2010). Эпидемиологическая информация свидетельствует о том, что частота этих связанных с ВГС последствий, вероятно, будет продолжать расти в течение следующих 10-15 лет, если не появятся эффективные и хорошо переносимые методы лечения.Таким образом, разработка улучшенной противовирусной терапии является важным приоритетом общественного здравоохранения.

До недавнего времени наиболее эффективным лечением хронической инфекции ВГС было сочетание пегинтерферона и рибавирина на срок до 48 недель. При таком режиме устойчивый вирусологический ответ (УВО), определяемый как неопределяемая РНК ВГС через 24 недели после завершения противовирусного лечения, составляет приблизительно 50-60% (Hoofnagle 2006). Однако не все пациенты могут завершить терапию; до 10% преждевременно прекратят прием из-за невыносимых побочных эффектов, преимущественно депрессии и / или усталости (Seeff 2010).Основными детерминантами реакции на противовирусную терапию являются вирусный генотип и выбранные характеристики хозяина. Генотип 1 гепатита С (HCV-1), на который приходится примерно 70% хронических инфекций в Северной Америке, относительно устойчив к лечению пегинтерфероном и рибавирином. УВО при лечении HCV-1 составляет примерно 40% (Hoofnagle, 2006). Тем не менее, среди людей, инфицированных HCV-1, наблюдается разнообразие в УВО, которое коррелирует с полиморфизмом динуклеотидов в локусе выше гена интерлейкина 28B (IL28B).В частности, при 48-недельной терапии пегинтерфероном и рибавирином 70% лиц с полиморфизмом IL28B CC достигают УВО, по сравнению только с 30% лиц с другими полиморфизмами IL28B (Thompson 2010).

Теперь доступны новые методы лечения хронической инфекции HCV-1. В мае 2011 года Управление по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA) одобрило телапревир, пероральный низкомолекулярный ингибитор протеазы ВГС-1, для лечения хронического ВГС-1 в комбинации с пегинтерфероном и рибавирином.Было показано, что у пациентов, инфицированных HCV-1, этот режим из трех препаратов дает УВО 75% (Jacobson 2011). Однако этот режим, по-видимому, связан с почти 1,5-кратным увеличением преждевременного прекращения приема препарата по сравнению с режимом пегинтерферона и одного рибавирина, в значительной степени под влиянием развития сыпи, связанной с телапревиром. Учитывая высокую чувствительность к обычному пегинтерферону и рибавирину среди лиц, инфицированных HCV-1 с полиморфизмом CC IL28B, мы предполагаем, что УВО не будет увеличиваться у таких лиц при добавлении телапревира к терапии пегинтерфероном и рибавирином.Если это верно, пациентов, инфицированных HCV-1 с полиморфизмом CC IL28B, можно будет лечить с сопоставимым успехом только пегинтерфероном и рибавирином, и, следовательно, они будут избавлены от побочных эффектов, связанных с телапревиром.

Предлагаемое исследование, которое представляет собой проспективное рандомизированное открытое исследование (с участием лиц, инфицированных HCV-1 с полиморфизмом IL28B CC) лечения телапревиром (T), пегинтерфероном (P) и рибавирином (R) по сравнению с одним PR, будет проверить рабочую гипотезу. В дизайне исследования используется концепция лечения, ориентированного на ответ, стратегия, в которой продолжительность противовирусного лечения зависит от наличия или отсутствия быстрого вирусологического ответа (RVR), определяемого как потеря определяемой сывороточной РНК HCV в течение первого 4 недели терапии.В частности, было показано, что пациенты с HCV-1, у которых достигается БВО (и сохраняется неопределяемая РНК ВГС через 12 недель (определяемая как эВР), при схемах, содержащих PR или TPR, наблюдается сопоставимый УВО через 24 недели по сравнению с 48. недель общего лечения (Mangia 2008, Jacobson 2011).

Генотип 1 и генотип 2 Норовирусы крупного рогатого скота отличаются по антигенам, но имеют общий перекрестно-реактивный эпитоп с норовирусами человека

РЕЗЮМЕ

Кишечные калицивирусы крупного рогатого скота Bo / Jena / 1980 / DE и Bo / Newbury2 / 1976 / UK представляют два различных генотипа в пределах новой геногруппы, геногруппы III, в роду Norovirus семейства Caliciviridae . В настоящем исследовании антигенное родство этих двух генотипов было впервые определено для разработки тестов для обнаружения и дифференциации обоих генотипов. Использовались два подхода. Во-первых, перекрестная реактивность была исследована с помощью иммуноферментного анализа (ELISA) с использованием рекомбинантных вирусоподобных частиц (VLP) и сыворотки в фазе выздоровления от телят, инфицированных либо Jena (генотип 1), либо Newbury2 (генотип 2). Во-вторых, была исследована перекрестная реактивность между двумя генотипами с моноклональным антителом CM39, полученным с использованием Jena VLP.Два генотипа, Jena и Newbury2, были антигенно различными с небольшой перекрестной реактивностью по данным ELISA или отсутствием перекрестной реактивности с гетерологичными VLP с использованием сыворотки выздоравливающих телят, которые имели титры гомологичных иммуноглобулинов G log 10 от 3,1 до 3,3. CM39 реагировал как с Jena, так и с гетерологичными VLP Newbury2. Эпитоп CM39 был сопоставлен с девятью аминокислотами ( 31 PTAGAQIAA 39 ) в капсидном белке Jena, который не был полностью консервативен для Newbury2 ( 31 PTAGAPVAA 39 ). Молекулярное моделирование показало, что эпитоп CM39 находится в пределах конечного плеча NH 2 внутри капсида вируса. Неожиданно CM39 также реагировал с VLP из двух норовирусов человека геногруппы II / 3 с помощью ELISA и вестерн-блоттинга. Таким образом, хотя бычьи норовирусы Jena и Newbury2 соответствовали двум разным антигенным типам или серотипам, они имели по крайней мере один перекрестно-реактивный эпитоп. Эти результаты имеют отношение к эпидемиологическим исследованиям для определения распространенности серотипов бычьих норовирусов и для разработки вакцин против бычьих норовирусов.

Вирусы, похожие на калицивирусы, были впервые зарегистрированы в связи с диареей телят в Соединенном Королевстве в 1978 г. и в Германии в 1980 г. (1, 15, 40). Исследования на экспериментальном крупном рогатом скоте показали, что вирусы из обеих стран были кишечными патогенами, но дальнейшая характеристика этих вирусов была затруднена из-за отсутствия системы культивирования клеток и геномной информации (7, 14). Недавно были получены геномные данные по двум вирусам, Bo / Newbury2 / 1976 / UK и Bo / Jena / 1980 / DE, которые были идентифицированы первоначально (9, 25, 31).Оба имеют геномы размером 7,3 т.п.н., организованные в три открытые рамки считывания, и были отнесены к новой геногруппе, геногруппе III, норовирусов, в семействе Caliciviridae (3, 9, 25, 31).

Были явные различия между геномами Йены и Ньюбери2. Анализ генов полимеразы, капсида и ORF3 поместил каждый вирус в отдельный генетический кластер или генотип с идентичностью только 68% аминокислот в их полных белках капсида. Дополнительные изоляты коровьих норовирусов генотипа 1 (Йена) или генотипа 2 (Ньюбери2) были идентифицированы из Соединенного Королевства, Нидерландов и США (30, 31, 34, 37, 39), что подтверждает существование двух различных генотипы.Вирусы в пределах одного генотипа имели от 91 до 99% аминокислотной идентичности в своих полных капсидных белках (17, 30, 31, 34). Большинство аминокислотных вариаций происходило в выступающих или Р-доменах белков капсида. Это подняло вопрос об антигенном родстве между двумя генотипами бычьего норовируса и о том, могут ли серологические методы, обнаруживающие один, обнаруживать другой.

ПЦР с обратной транскрипцией (ОТ-ПЦР), основанная на гене полимеразы, использовалась в качестве основного метода диагностики бычьих норовирусов (30, 34, 37, 39).Это привело к их признанию и подчеркнуло необходимость определения точной роли норовирусов крупного рогатого скота в синдроме диареи телят. Капсидные гены вирусов генотипа 1 выявляются реже, чем вирусов генотипа 2 (17, 30, 31, 34, 39). Из 26 полных генов капсида, доступных в настоящее время для норовирусов крупного рогатого скота в GenBank, только 5 относятся к генотипу 1, а оставшийся 21 генотип 2. Требуются данные о распространенности норовирусов крупного рогатого скота в популяциях крупного рогатого скота, распространенности двух генотипов и роли обоих в болезни.К настоящему времени идентифицировано только два генотипа норовирусов крупного рогатого скота III геногруппы.

Распространенность бычьих норовирусов генотипов 1 и 2 легче всего изучить с помощью серологических методов определения антигена и антител. Серологические методы для вируса Йены были разработаны на основе рекомбинантных вирусоподобных частиц (VLP), используемых в качестве антигена для обнаружения сывороточного иммуноглобулина G (IgG) или для создания поликлональных антисывороток для обнаружения вирусного антигена с помощью иммуноферментного анализа (ELISA) ( 11).Совсем недавно серологические методы были также разработаны для вируса Newbury2 (S.L.Oliver, E. Asobayire, A. Charpilliene, J. Cohen и J. C. Bridger, представленные для публикации). Однако значительные различия в прогнозируемых аминокислотных составах капсидных белков коровьих норовирусов генотипов 1 и 2 предполагают, что серологические тесты не обнаруживают оба генотипа и их антитела, но это еще предстоит доказать.

Используя два подхода, в настоящем исследовании было определено антигенное родство двух генотипов бычьего норовируса, что позволило разработать тесты для обнаружения и дифференциации обоих генотипов. Во-первых, чтобы установить, представляют ли бычьи норовирусы генотипа 1 и 2 два серотипа, перекрестную реактивность выздоравливающих антисывороток от телят, экспериментально инфицированных либо Jena, Newbury2, либо Newbury2-подобным вирусом, Дамфрис исследовали с помощью ELISA с использованием рекомбинантных VLP, полученных из Jena и Ньюбери 2. Во-вторых, перекрестная реактивность моноклонального антитела, полученного с использованием Jena VLPs, была определена с конечной целью разработать перекрестно-реактивный ELISA, специфичный для бычьих норовирусов геногруппы III.

МАТЕРИАЛЫ И МЕТОДЫ

Вирусы и антисыворотки. Использовались выздоравливающие антисыворотки к трем норовирусам крупного рогатого скота: Bo / Newbury2 / 1976 / UK, идентифицированным в южной Англии (40), Bo / Jena / 1980 / DE, идентифицированным в Германии, и Bo / Dumfries / 1994 / UK, обнаружен в Дамфрисе, Шотландия (31). Выздоравливающие антисыворотки к бычьему норовирусу Jena генотипа 1 получали от телят, лишенных молозива, через 14 дней после пероральной инокуляции вирусом Jena. Выздоравливающая антисыворотка к бычьим норовирусам генотипа 2 была получена через 22 дня после однократной пероральной инокуляции гнотобиотических телят вирусом Ньюбери2 (7) или через 14 дней после однократной инокуляции теленка, лишенного молозива, вирусом Дамфриса (любезно предоставлено Дэвидом Снодграссом, Biobest ).В качестве отрицательного контроля использовали бычью антисыворотку к вирусу Newbury1 и бычий ротавирус UK (6, 7). Вирус Newbury1 представляет собой неклассифицированный калицивирус с ≤21% идентичностью аминокислот в своем полном капсидном белке с Jena и Newbury2 (S. L. Oliver, E. Asobayire, A. M. Dastjerdi и J. C. Bridger, представленные для публикации).

Получение VLP и слитых белков GST-капсид из бычьих и человеческих норовирусов. VLP Jena и Newbury2 получали, как описано в другом месте (11; Oliver, Asobayire, Charpilliene, et al., Отправлено). VLP для норовирусов человека геногруппы I Hu / Southampton / 1991 / UK и норовирусов человека геногруппы II Hu / RBH / 1993 / UK, Hu / Lordsdale / 1993 / UK и Hu / Leeds / 1990 / UK получали, как описано ранее ( 12, 32). VLP для следующих человеческих норовирусов были подарками: Hu / Norwalk / 1968 / US (Мэри Эстес, Медицинский колледж Бейлор, Техас), Hu / Hawaii / 1971 / US, Hu / SnowMountain / 1976 / US и Hu / DesertShield395 / 1990. / SA (Ким Грин, NIH, Мэриленд) и Hu / Toronto / 1991 / CAN (Стефан Монро, CDC, Джорджия).Слитые белки глутатион S -трансфераза (GST) -капсид были получены из генов капсида для геногруппы III норовируса крупного рогатого скота Jena и геногруппы I норовирусов человека Southampton, Norwalk и Desert Shield, а также норовирусов человека геногруппы II Hawaii, Snow Mountain, Торонто, РБХ, Лордсдейл и Лидс. Их клонировали в вектор pGex 4T1 (Amersham Biosciences UK Ltd., Великобритания) и использовали для трансформации Escherichia coli . Синтез белка индуцировали изопропил-β-d-тиогалактопиранозидом (100 мМ), и культуры инкубировали в течение ночи при 25 ° C.Большая часть белка была выражена в виде телец включения, как определено с помощью электронной микроскопии. Слитые белки GST-капсид очищали от телец включения с помощью Bugbuster (Novagen, Merck Biosciences Ltd., Великобритания) в соответствии с инструкциями производителя.

Обнаружение IgG бычьего норовируса с помощью ELISA. Планшеты Maxisorb (Nunc) покрывали 5 мкг / мл антигена VLP в карбонатном буфере, pH 9,6, в течение ночи при 4 ° C. Используемые антигены представляли собой очищенные CsCl VLP Jena и Newbury2 плюс супернатанты из клеток Sf9, инфицированных бакуловирусом дикого типа (фиктивный антиген).Планшеты блокировали 2% обезжиренным сухим обезжиренным молоком в фосфатно-солевом буфере (PBS) и промывали PBST (PBS плюс 0,05% Tween 20 [Sigma-Aldrich Company Ltd., Великобритания]) между каждым этапом. Антисыворотку от экспериментальных телят разводили от 1:50 в серии двукратных разведений в 1% обезжиренном сухом обезжиренном молоке в PBST, разливали в лунки, предварительно покрытые VLP или ложным антигеном, и инкубировали при комнатной температуре в течение 1 часа. После промывки разведение 1: 10000 конъюгата кроличьего антитела против бычьего IgG-пероксидазы хрена (Sigma-Aldrich Company Ltd. , Великобритания) в PBST плюс 1% обезжиренное сухое обезжиренное молоко и инкубировали в течение 1 ч при комнатной температуре. Активность пероксидазы определяли с использованием 3,3 ‘, 5,5’-тетраметилбензидина в качестве субстрата (Sigma-Aldrich Company Ltd., Соединенное Королевство), а оптическую плотность измеряли при 450 нм. Титры сыворотки рассчитывали с помощью линейной регрессии с использованием Prism 4 (программное обеспечение GraphPad). Пороговые значения определяли как удвоенное среднее значение чистой абсорбции при 450 нм (абсорбция с тестируемым антигеном минус абсорбция с ложным антигеном при каждом разведении) лунок без тестируемой сыворотки.

Производство моноклональных антител к Jena VLP. До иммунизации Jena VLP у мышей BALB / c с помощью ELISA, вестерн-блоттинга и анализа радиоиммунопреципитации (RIPA) не было ранее существовавших антител к Jena capsid protein. Мышей примировали внутрибрюшинно 50 мкг очищенных Jena VLP в полном адъюванте Фрейнда с последующими двумя внутрибрюшинными инъекциями Jena VLP в неполном адъюванте Freund с 14-дневными интервалами. Последняя внутривенная инъекция Jena VLPs вводилась за 3 дня до получения гибридомы.Клетки селезенки, выделенные от мышей, сливали в полиэтиленгликоле 4000 (Gibco BRL, Великобритания) с клетками плазмоцитомы BALB / c P3-NS-1. Гибридные клетки высевали в 96-луночные планшеты, содержащие перитонеальные макрофаги от мышей CD-1 в среде гипоксантин-аминоптерин-тимидин (RPMI 1640, 20% фетальная бычья сыворотка, 1% 200 мМ l-глутамин, 1% пируват натрия, 0,2% гентамицин. , 2% гипоксантин-аминоптерин-тимидин [50 ×], 1% пенициллин-стрептомицин). Супернатанты клеточных культур из гибридом, которые показали реактивность к Jena VLP с помощью ELISA, клонировали путем терминального разведения, и их супернатанты собирали для дальнейшего анализа.

Специфичность с помощью ELISA моноклональных антител CM39 к VLP бычьего и человеческого норовируса и капсидным белкам GST-слияния. 96-луночные поливиниловые планшеты (INC Labs) были покрыты VLP или GST-слитыми белками в карбонатном буфере, pH 9,6, при 2 мкг / мл. Планшеты инкубировали в течение ночи во влажной среде при 4 ° C. Планшеты промывали PBST между каждым этапом. Планшеты блокировали 5% обезжиренным сухим обезжиренным молоком в PBS в течение 30 минут при 37 ° C, а затем добавляли разбавление 1: 5 супернатанта гибридомы, содержащего моноклональное антитело CM39 в PBST, плюс 1% обезжиренного сухого обезжиренного молока и инкубировали в течение 90 мин при 37 ° C.Разведение 1: 3000 козьих антимышиных поливалентных антител, конъюгированных с пероксидазой хрена (Sigma-Aldrich Company Ltd., Соединенное Королевство), разведенных в PBS плюс 1% обезжиренного сухого обезжиренного молока, добавляли в чашки и инкубировали еще 90 мин при 37 ° С. Активность пероксидазы определяли с использованием 0,1% ацетата натрия (pH 6,0) -0,1% тетраметилбензидина-0,01% H 2 O 2 , а оптическую плотность измеряли при 450 нм.

SDS-PAGE и иммуноокрашивание капсидных белков. Капсидные белки бычьего и человеческого норовируса, экспрессированные in vitro в виде VLP или GST-слитых белков, разделяли электрофорезом в полиакриламидном геле додецилсульфата натрия (SDS-PAGE) с использованием 12. 5% -ный полиакриламидный гель методом прерывистого буфера (22). Белки капсида подвергали электроблоттингу на нитроцеллюлозных мембранах в буфере для переноса (Трис-HCl, 25 мМ; глицин, 192 мМ; SDS, 0,1%; метанол, 20%) с использованием полусухого блоттера Trans-Blot SD (Bio-Rad Laboratories Ltd., United Королевство). Мембраны инкубировали при 37 ° C в блокирующем растворе TBS (NaCl, 0,5 М; Трис-HCl, 20 мМ [pH 7,5]), содержащем 0,05% Твин 20 плюс 5% сухого обезжиренного молока. Последующие инкубации проводили при комнатной температуре.Мембраны дважды промывали блокирующим раствором и один раз TBS, а затем инкубировали в течение 16 часов с супернатантом гибридомы моноклонального антитела CM39, разведенным 1:20 в блокирующем растворе, содержащем 10% нормальную козью сыворотку. После отмывки мембраны инкубировали с разведением 1: 1000 козьего антимышиного IgG, конъюгированного с щелочной фосфатазой (Sigma-Aldrich Company Ltd., Великобритания). Активность щелочной фосфатазы детектировали с использованием тетразолиевой соли бром-хлориндолил-фосфат-нитробиний (Sigma-Aldrich Company Ltd. , Объединенное Королевство).

In vitro транскрипция и трансляция полных и частичных белков капсида Jena. Полный белок капсида Jena плюс четыре усеченных на С-конце фрагмента капсида использовали для определения местоположения области, в которой связывается моноклональное антитело CM39. Матрица, используемая для транскрипции полного капсидного белка in vitro, представляла собой полноразмерный ген капсида, клонированный в pRSETA (Invitrogen Ltd., Великобритания). ПЦР-ампликоны, полученные из этой конструкции, использовали для четырех фрагментов, от F1 до F4, капсидного белка.Прямой праймер (5′-GATCTCGATCCCGCGAAATT-3 ‘) был расположен в последовательности вектора pRSETA непосредственно перед областью промотора Т7. Антисмысловые праймеры, использованные для создания четырех фрагментов, представляли собой JVF3R (5’-TTA 5871 GAGTGGTTCCAAGCAAATCG 5851 -3 ‘), JVF4R (5’-TTA 5759 ATTGGTGAGACTGTA3AACTG4 (5′-TTA) GTA3AACTG4 -TTA 5670 AATCAGGGCTTGGACAGGTT 5650 -3 ‘) и JVF6R (5’-TTA 5500 GCACGGACATCCATTATCAC 5480 -3′). Координаты нуклеотидов для олигонуклеотидов взяты из полноразмерной геномной последовательности вируса Jena с кодоном преждевременной терминации на 5′-конце каждого олигонуклеотида.Трансляцию in vitro выполняли с 0,1 мкг до 1 мкг очищенной ДНК (Genelute Miniprep или Midiprep; Sigma) с использованием системы лизата кроличьих ретикулоцитов, связанных с РНК-полимеразой Т7 (TNT; Promega, Великобритания), в соответствии с инструкциями производителя для реакционных объемов 50. мкл, содержащий [ 35 S] метионин. Реакционные смеси инкубировали в течение 2 ч при 30 ° C, а затем разделяли с помощью SDS-PAGE. Гели помещали в раствор салицилата (1 М салицилат натрия, 50% метанол) на 30 мин при комнатной температуре для усиления сигнала, полученного авторадиографией.Гели, высушенные под вакуумом на хроматографической бумаге, подвергали воздействию пленки Kodak XAR-5 в течение ночи при -70 ° C в кассете для авторадиографии перед проявлением пленки.

RIPA. Смеси для реакций транскрипции-трансляции in vitro плюс неразбавленная антисыворотка или моноклональное антитело CM39 в буфере RIPA (10 мМ трис-HCl [pH 7,5], 1 мМ ЭДТА, 0,15 мМ NaCl, 0,1% SDS, 0,5% Empigen BB [ N -додецил- N , N -диметилглицин], 0,1 мМ фенилметилсульфонилфторид) инкубировали в течение 1 ч при 37 ° C. Для адсорбции иммунных комплексов к реакционным смесям добавляли козий антимышиный IgG, прикрепленный к гранулам агарозы (Sigma-Aldrich Company Ltd., Великобритания), а затем инкубировали в течение 2 ч при комнатной температуре. Гранулы промывали трижды в буфере RIPA и один раз в PBS. Иммунные комплексы солюбилизировали буфером для диссоциации образцов, а затем разделяли с помощью SDS-PAGE, и гели готовили для авторадиографии, как описано ранее.

Анализ эпитопа. Для картирования эпитопа, распознаваемого моноклональным антителом CM39, твердофазный пептидный массив, состоящий из 48 перекрывающихся додекапептидов, смещенных на три аминокислоты, был коммерчески синтезирован на серии твердофазных пэков (Mimotopes Ltd., ВЕЛИКОБРИТАНИЯ). Пептиды охватывают 153 аминокислоты для NH 2 -концевой области капсидного белка Jena. Анализ эпитопов проводили в соответствии с протоколом производителя. Пептиды в 96-луночном поливиниловом планшете погружали в буфер для предварительного покрытия (2% бычий сывороточный альбумин, 0,1% Твин 20 и 0,1% азид натрия в PBS) на 1 час при комнатной температуре, а затем инкубировали в течение ночи при 4 ° C с CM39. супернатант гибридомы, разбавленный 1: 5 в буфере для предварительного покрытия. Пептиды промывали PBS между каждым этапом.Добавляли козье антимышиное поливалентное антитело, конъюгированное с пероксидазой хрена (Sigma-Aldrich Company Ltd., Великобритания), разведенное до 1: 3000 в PBS, содержащем 1% нормальной козьей сыворотки, 0,1% Твин 20 и 0,1% казеината натрия, и затем смесь инкубировали 1 ч при комнатной температуре. Активность пероксидазы определяли с использованием 0,05% 2,2′-азинобис (3-этилбензтиазолинсульфоновой кислоты), растворенного в субстратном буфере (0,1 M Na 2 HPO 4 , 0,08 M ​​лимонной кислоты, pH 4,0 и 0,01% H 2 О 2 ), а оптическую плотность измеряли при 405 нм.

Молекулярное моделирование. Модель гомологии капсидного белка Newbury2 была создана с использованием сервера Swiss-Model (http://swissmodel.expasy.org/
). Координаты четвертичной структуры пятикратной оси симметрии для структуры рентгеновской кристаллографии вируса Norwalk (номер доступа PDB 1ihm) были получены из базы данных макромолекулярных структур (http://pqs. ebi.ac.uk/
). Чтобы показать расположение последовательности эпитопа Jena ( 31 PTAGAQIAA 39 ) в мономере капсидного белка Newbury2 (последовательность эпитопа 31 PTAGAPVAA 39 для капсидного белка Newbury2) и ось симметрии пятого порядка вируса Norwalk файлы изображений были созданы с помощью программного обеспечения VMD 1.8.2 (19). Pov-ray для Windows использовался для создания изображений с трассировкой лучей для всех структур. Аминокислотное выравнивание капсидных белков Norwalk и Newbury2 показало, что последовательность вируса Norwalk 35 PVAGSSTAV 43 эквивалентна последовательности 31 PTAGAPVAA 39 Newbury2. Домены капсидного белка Newbury2, эквивалентные доменам вируса Norwalk, были взяты как аминокислоты с 1 по 45 для NH 2 -концевого домена, от 46 до 218 для S-домена, от 219 до 272 и от 396 до 522 для домена P1. и от 273 до 395 для домена P2.

РЕЗУЛЬТАТЫ

Перекрестная реактивность между Bo / Jena / 1980 / DE и Bo / Newbury2 / 1976 / UK по данным ELISA с использованием антисыворотки выздоравливающих телят. Два вируса, Jena (генотип 1) и Newbury2 (генотип 2), были антигенно разными . Была обнаружена неопределяемая или низкая перекрестная реактивность с гетерологичным антигеном и антисывороткой выздоравливающих от шести телят, инокулированных либо Jena, либо Newbury2 (таблица 1). Среднее значение log 10 титров IgG к гомологичным антигенам находилось между 3,1 (σ = 0,0) и 3,3 (σ = 0.9), что более чем в 1000 раз выше, чем у гетерологичных антигенов. Сыворотки перед инокуляцией телят, инокулированных Jena и Newbury2, и антисыворотки от телят, инфицированных Newbury1 и штаммом ротавируса крупного рогатого скота UK, не показали реактивности ни с одним из антигенов (log 10 <1,7). Отсутствие перекрестной реактивности между двумя генотипами было подтверждено с помощью антисыворотки к Newbury2-подобному вирусу Bo / Dumfries / 1994 / UK.

ТАБЛИЦА 1.

титров IgG по данным ELISA с использованием VLP Jena или Newbury2 с антисывороткой от телят, инфицированных бычьими норовирусами Jena, Newbury2 или Dumfries или Newbury1 или ротавирусом крупного рогатого скота UK

Перекрестная реактивность между Bo / Jena / 1980 / DE и Bo / Newbury2 / 1976 / UK с моноклональным антителом CM39. Моноклональное антитело CM39, полученное с использованием Jena VLP, реагировало с гомологичными Jena VLP и гибридным белком GST-Jena в Вестерн-блоттинге, RIPA и ELISA (рис. 1 и таблица 2). Моноклональное антитело CM39 сильно перекрестно реагировало с Newbury2 с помощью вестерн-блоттинга и ELISA, показывая наличие общего эпитопа в генотипах 1 и 2 норовирусов крупного рогатого скота. Положение последовательности узнавания CM39 было локализовано с помощью RIPA на NH 2 -концевых 149 аминокислотах капсидного белка Jena.Все четыре белка, от F1 до F4, ожидаемых молекулярных масс были осаждены CM39, включая самый короткий белок, F4 (рис. 2).

РИС. 1.

Реакция вестерн-блоттинга моноклонального антитела CM39 с капсидными белками из VLP двух генотипов бычьих норовирусов, Jena (генотип 1) и Newbury2 (генотип 2), и норовирусов Lordsdale (генотип 4) геногруппы II человека и Торонто (генотип 3).

РИС. 2. Рентгенограмма

, показывающая полные и частичные фрагменты (с F1 по F4) капсидного белка Jena, которые были осаждены моноклональным антителом CM39 с использованием RIPA. Серые столбцы под авторадиографом показывают длину в аминокислотах и ​​прогнозируемую молекулярную массу полного капсидного белка Jena плюс усеченных на С-конце фрагментов, полученных в результате транскрипции-трансляции. Стрелки показывают ожидаемую миграцию полных и частичных фрагментов капсидного белка Jena. Внутренняя трансляция кодонов инициации в векторе дает белки с более высокой молекулярной массой, чем ожидалось.

ТАБЛИЦА 2.

Реактивность моноклонального антитела CM39 к капсидным белкам норовируса, экспрессируемым в виде VLP, слитых белков GST или радиоактивно меченных белков и обнаруживаемых с помощью ELISA, вестерн-блоттинга или RIPA

Эпитоп, ответственный за перекрестную реактивность Jena и Newbury2, был успешно картирован в область между аминокислотами 28 и 42 капсидного белка.Из 48 додекамеров, компенсированных 3 аминокислотами, которые были образованы для 153 аминокислот, охватывающих NH 2 -концевую область капсидного белка Jena, 6 проявили реактивность с моноклональным антителом CM39. Пептиды 10 ( 28 PVEPTAGAQIAA 39 ) и 11 ( 31 PTAGAQIAAPTA 42 ) показали самые высокие уровни реактивности, при этом реактивность других пептидов чуть выше фоновых уровней (фиг. 3). Визуальный осмотр двух перекрывающихся пептидов определил эпитоп как девять аминокислотных остатков, 31 PTAGAQIAA 39 , в последовательности Jena.Гомологические модели капсидных белков бычьего норовируса показали, что эпитоп СМ39 расположен в NH 2 -концевом плече капсидного белка (фиг. 4A). Последовательность 31 PTAGAQIAA 39 была уникальной для норовируса Йены. Newbury2 имеет две аминокислотные замены, Q36 → P и I37 → V, но дает перекрестную реакцию в анализе ELISA и вестерн-блоттинга, что позволяет предположить, что аминокислоты P36 и V37 не являются критическими контактными остатками в сайте связывания антитела. Это можно объяснить линейной конформацией, образованной остатками от P31 до A35, A38 и A39 эпитопа CM39 (рис. 4Б). Кроме того, предсказанная доступность растворителя для этих остатков была практически идентична для Jena и Newbury2 (не показано). Макромолекулярная модель пятикратной оси симметрии для вируса Norwalk показала, что эпитоп будет располагаться внутри вириона (рис. 4C и D). Присутствие частично сформированных VLP, часто наблюдаемых с помощью электронной микроскопии (данные не показаны), объясняет реактивность моноклонального антитела CM39 с VLP.

РИС. 3.

Иммунореактивность с помощью ELISA моноклонального антитела CM39 с 48 додекапептидами, образованными из 153 аминокислот на NH 2 конце капсидного белка Jena.

РИС. 4.

Молекулярные модели, показывающие расположение в капсидном белке эпитопа ( 31 PTAGAQIAA 39 ; фиолетовое заполнение пространства), распознаваемого моноклональным антителом CM39. (A) Модель гомологии капсидного белка Newbury2, созданная с использованием Swiss-Model. Зеленый, NH 2 -концевые аминокислоты; желтый, домен S; красный, домен P1; синий, домен P2. (B) Эпитоп CM39, показывающий расположение аминокислотных замен Q36 → P и I37 → V (желтый) в белке Newbury2 по сравнению с Jena и линейную конформацию аминокислот от P31 до A35 и A38 и A39 (фиолетовый).P31 и A39 соответствуют концам NH 2 и COOH эпитопной последовательности CM39. (C и D) Пятикратная ось симметрии норовируса Norwalk геногруппы I человека при взгляде сверху (C) или сбоку (D), показывающая вероятное расположение эпитопа бычьего норовируса для CM39.

Перекрестная реактивность между бычьим и человеческим норовирусами с использованием моноклонального антитела CM39. Моноклональное антитело CM39 не имело перекрестной реакции с помощью ELISA с VLP из трех норовирусов человека геногруппы I генотипов 1–3 и GST-слитым белком геногруппы I / генотип 2 Капсид вируса Саутгемптона (таблица 2).Отсутствие перекрестной реактивности коррелировало с заменами от трех до шести аминокислот в последовательностях норовируса человека по сравнению с аминокислотной последовательностью Jena. Моноклональное антитело CM39 также не давало перекрестной реакции с VLP для четырех из шести человеческих норовирусов II генотипов 1, 2, 4 и 7. Отсутствие перекрестной реактивности коррелировало с заменами двух-четырех аминокислот по сравнению с Jena. Однако CM39 перекрестно реагировал с VLP из двух норовирусов человека геногруппы II / генотипа 3, вирусов Toronto и RBH, хотя и в меньшей степени, чем с VLP Jena и Newbury2.Перекрестная реактивность проявлялась при двух или трех аминокислотных заменах и была подтверждена вестерн-блоттингом для вируса Торонто и ELISA с использованием слитого белка капсида GST-RBH.

Эти результаты показали, что эпитоп CM39 допускает определенные типы аминокислотных замен, но сохраняет критические контактные остатки в первой (P), третьей (A), четвертой (G), восьмой (A) и девятой (A) аминокислотах. . Консенсусная последовательность ( 1 PT / VAGA / SQ / P / AI / VAA 9 ; консервативные остатки подчеркнуты) девяти аминокислотного эпитопа для четырех перекрестно-реактивных капсидных белков содержала аминокислотные замены, которые были либо небольшие нейтральные (валин и / или аланин) или небольшие незаряженные полярные (пролин или серин) остатки (таблица 2). Белки капсида из перекрестно-реактивных и нереактивных норовирусов человека содержали валин во втором положении в эпитопе CM39, что вряд ли могло повлиять на перекрестную реактивность. Перекрестная реактивность отменялась для норовирусов человека геногруппы II, если имелась замена серина в шестой аминокислоте или аланине плюс по крайней мере одна дополнительная замена в третьей, седьмой или девятой аминокислоте в последовательности эпитопа.

ОБСУЖДЕНИЕ

Настоящее исследование впервые показало, что два генотипа норовирусов геногруппы III соответствуют двум различным антигенным типам, или серотипам, по данным ELISA с антисывороткой для выздоравливающих.Однако эти два генотипа имели общий эпитоп, расположенный в пределах NH 2 -концевого плеча капсидного белка, идентифицированного по перекрестной реактивности моноклонального антитела CM39 как с Jena, так и с Newbury2. Неожиданно CM39 также обнаружил перекрестно-реактивный эпитоп в некоторых норовирусах геногруппы II человека.

Корреляция между различиями геномных последовательностей и отсутствием перекрестной антигенной реактивности с выздоравливающими антисыворотками поддержала филогенетическое подразделение генотипа 1 (Jena) и генотипа 2 (Newbury2) бычьих норовирусов.Это отразило ситуацию для генотипов норовирусов человека I и II геногрупп. Первоначально с помощью иммуно-электронной микроскопии было продемонстрировано антигенное различие норовирусов человека (23, 24, 29). Последующие исследования показали, что генотипы были антигенно различны в геногруппах норовирусов человека с помощью ELISA с использованием антисыворотки для выздоравливающих с VLP (5, 13, 28). Корреляция генотипа с серотипом была дополнительно подтверждена, когда кроликов вакцинировали VLP норовируса человека, с помощью которых было продемонстрировано четкое антигенное различие между генотипами норовируса (20).Однако некоторые антисыворотки выздоравливающего человека показали перекрестную реактивность между генотипами (5, 13, 28), что могло быть следствием предварительного контакта с разными генотипами норовируса человека. Настоящее исследование продемонстрировало преимущество использования крупного рогатого скота, содержащегося в контролируемых условиях, для предотвращения предварительного контакта с норовирусами, что составляет основу модели норовирусной диареи для изучения антигенных взаимоотношений и иммунных ответов после заражения.

Способность различать инфекции, вызванные двумя серотипами бычьего норовируса, позволит определять распространенность антител каждого серотипа в популяциях крупного рогатого скота.Вирусы, подобные Newbury2 (генотип 2), были преобладающим генотипом, идентифицированным на сегодняшний день с помощью ОТ-ПЦР в Соединенном Королевстве, Нидерландах и Северной Америке (31, 34, 37-39). Генотип, подобный Йене (генотип 1), редко выявлялся с помощью ОТ-ПЦР в этих странах. Однако антитела к генотипу 1 были повсеместно распространены у немецкого крупного рогатого скота, при этом 99,1% крупного рогатого скота имели Jena IgG, а вирус Jena был обнаружен с помощью ELISA (11). Результаты настоящего документа позволят провести исследования, чтобы установить распространенность антител обоих серотипов и установить, существуют ли различия в распространенности в разных странах.

Для оценки роли обоих норовирусов крупного рогатого скота в диарее крупного рогатого скота необходимы тесты на основе ELISA, которые выявляют вирионы обоих серотипов и обрабатывают большое количество образцов, аналогично тестам, доступным для ротавирусов группы A (2, 26, 27) . Текущие анализы на бычьи норовирусы используют ОТ-ПЦР и обычно основаны на гене полимеразы, который может обнаруживать оба генотипа (31, 34, 38, 39). Однако обработка большого количества образцов с помощью ОТ-ПЦР трудоемка. Кроме того, были идентифицированы химерные норовирусы крупного рогатого скота, что привело к неправильной диагностике типа капсида (серотипа) с помощью ОТ-ПЦР на основе полимеразных праймеров (17, 30, 39).Обнаружение того, что моноклональное антитело CM39 было перекрестно реактивным к обоим серотипам, было многообещающим для разработки широко реактивного ELISA. К сожалению, не удалось разработать антигенный ELISA, поскольку CM39 не обнаруживал вирионы Jena в образцах фекалий экспериментальных телят при использовании в сочетании с поликлональной кроличьей антисывороткой к Jena VLPs (неопубликованное наблюдение), которая успешно использовалась в ELISA для обнаружения Jena вирионы в образцах фекалий (11). В отличие от норовирусов геногрупп I и II человека, только два генотипа (серотипа) бычьих норовирусов были обнаружены в Соединенном Королевстве, континентальной Европе и США (31, 34, 38, 39).Аминокислотная идентичность Р-домена капсида в каждом генотипе бычьего норовируса высока (17, 31, 39), что делает вероятным, что вирусы в каждом генотипе будут перекрестно реагировать с поликлональными антисыворотками. Таким образом, до тех пор, пока не будет найдено подходящее моноклональное антитело, можно будет использовать ELISA для каждого серотипа на основе поликлональных антисывороток.

Отсутствие реактивности CM39 по отношению к нативным вирионам в образцах фекалий можно объяснить расположением эпитопа в концевом домене NH 2 на внутренней поверхности нативных вирионов.Несмотря на скрытую природу эпитопа в природных вирионах и VLP, CM39 показал реактивность с помощью ELISA, вестерн-блоттинга и RIPA по отношению к экспрессируемым in vitro капсидным белкам норовирусов крупного рогатого скота. Такая реактивность может быть объяснена присутствием неполных VLP, видимых с помощью электронной микроскопии, что позволяет экспонировать эпитоп на мономерах, димерах и других макромолекулярных структурах капсидного белка или, в случае RIPA и слитых белков GST-капсид, линеаризация капсидного белка.

Перекрестная реактивность CM39 между двумя серотипами бычьего норовируса позволяет предположить, что некоторые или все аминокислоты с P31 по A35, A38 и A39 в эпитопе CM39 были критическими контактными остатками, поскольку имелись две замены аминокислот, Q36 → P и I37 → V в капсидном белке Newbury2. Гомологические модели капсидных белков Jena и Newbury2 могут объяснить природу эпитопа. Аминокислотные остатки 36 и 37 образуют часть α-спирали, которая объединяет остатки P31 с A35, A38 и A39 в линейную конформацию, которая может сохраняться во время ELISA или вестерн-блоттинга капсидных белков Jena и Newbury2.Кроме того, аминокислотные замены не повлияли в какой-либо значительной степени на прогнозируемую доступность растворителя для остатков от P31 до A35, A38 и A39, поскольку они оставались практически идентичными для Jena и Newbury2. Таким образом, контакт между критическими остатками эпитопа и антигенсвязывающим сайтом моноклонального антитела CM39 будет сохраняться.

Демонстрация впервые перекрестно-реактивного эпитопа между норовирусами человека и крупного рогатого скота показала, что, хотя уровень реактивности был снижен, до трех аминокислотных замен можно было допустить.Это определило критические контактные остатки по крайней мере для пяти (P31, A33, G34, A38 и A39) из девяти аминокислот в эпитопе CM39. Подобно CM39, моноклональные антитела 1B4 и 1F6, которые были созданы к мексиканскому норовирусу человека NV36 геногруппы II / генотипа 3, оба связывались с перекрестно-реактивным эпитопом, который допускал до четырех аминокислотных замен (41, 42). Мы прогнозируем, что 1B4 и 1F6 будут связываться с бычьими норовирусами, потому что последовательность эпитопа NV36 ( 36 QQNIIDPWIMN 46 ) имела четыре аминокислотные замены по сравнению с последовательностью ( 44 QVNPIDPWIFA 54 ; консервативные аминокислоты). подчеркнут) для белков капсида Jena и Newbury2, которые были благоприятны для поддержания перекрестной реактивности.Другие моноклональные антитела также показали перекрестную реактивность между генотипами норовируса человека (8, 16, 18, 21). Такие перекрестно-реактивные моноклональные антитела, вероятно, являются искусственным явлением, поскольку они были получены из белков капсида, доставленных парентерально с сильным адъювантом. Выздоравливающая антисыворотка от экспериментальных телят в настоящем исследовании не содержала значительных уровней перекрестно-реактивных антител между Jena и Newbury2, даже несмотря на то, что сильная перекрестная реактивность была продемонстрирована с моноклональным CM39.

Вспышки диареи телят приводят к значительным экономическим потерям в Соединенном Королевстве (36). Энтеропатогены не обнаруживаются примерно в 30% образцов диареи телят, но норовирусы обычно не проверяются (4, 33, 35). Необходимы дальнейшие исследования, чтобы определить, преобладают ли оба норовируса крупного рогатого скота в популяциях крупного рогатого скота и вносят ли коровьи норовирусы значительный вклад в вспышки диареи телят. Результаты настоящего исследования позволят продолжить эти исследования.Если оба серотипа норовируса крупного рогатого скота связаны с диареей крупного рогатого скота, результаты настоящего исследования предполагают, что оба серотипа потребуются в вакцине для плотин для достижения пассивной защиты.

БЛАГОДАРНОСТИ

Эта работа была поддержана грантом Wellcome Trust номер 0659233.

СНОСКИ

    • Получены 30 сентября 2005 г.
    • Возвращены для модификации 2 декабря 2005 г.
    • Принято 23 декабря 2005 г.
      © 2006 Американское общество микробиологии

    ССЫЛКИ

    1. 1.№

      Алмейда, Дж. Д., К. Р. Крейг и Т. Э. Холл.
      1978. Множественные вирусы присутствуют в фекалиях чистящего теленка. Вет. Рек.102 : 170-171.

    2. 2.↵

      Аль-Юсиф, Ю., Дж. Андерсон, К. Чард-Бергстром, А. Бустаманте, М. Мюнценбергер, К. Остин и С. Капил.
      2001. Оценка набора для латексной агглютинации (Virogen Rotatest) для обнаружения ротавируса крупного рогатого скота в образцах фекалий. Clin. Диаг. Лаборатория. Immunol.8 : 496-498.

    3. 3.↵

      Андо Т., Дж. С. Ноэль и Р. Л. Фанкхаузер.
      2000. Генетическая классификация «норвалькоподобных вирусов». J. Infect. Dis.181 (Дополнение 2) : S336-S348.

    4. 4.↵

      Эндрюс, А. Х.
      2000. Энтерит телят — новая информация от НАДИС. UK Vet.5 : 30-34.

    5. 5.↵

      Беллиот, Г., Дж. С. Ноэль, Дж. Ф. Ли, Ю. Сето, К. Д. Хамфри, Т. Андо, Р. И. Гласс и С.С. Монро.
      2001. Характеристика генов капсида, экспрессируемых в бакуловирусной системе, трех новых генетически различных штаммов «норволкоподобных вирусов». J. Clin. Microbiol.39 : 4288-4295.

    6. 6.

      Бриджер, Дж. К., и Дж. Ф. Браун.
      1984. Антигенные и патогенные отношения трех ротавирусов крупного рогатого скота и ротавируса свиней. J. Gen. Virol.65 : 1151-1158.

    7. 7.↵

      Бриджер, Дж.К., Дж. А. Холл и Дж. Ф. Браун.
      1984. Характеристика калици-подобного вируса (агента Ньюбери), обнаруженного в связи с астровирусом при диарее крупного рогатого скота. Заразить. Immun.43 : 133-138.

    8. 8.

      Бринкер, Дж. П., Н. Р. Блэклоу, М. К. Эстес, К. Л. Мо, К. Дж. Шваб и Дж. Э. Херрманн.
      1998. Обнаружение вируса Norwalk и других калицивирусов человека геногруппы 1 с помощью моноклональных антител, иммуноферментный анализ на основе рекомбинантного антигена иммуноглобулина М.J. Clin. Microbiol.36 : 1064-1069.

    9. 9.

      Дастджерди, А. М., Дж. Грин, К. И. Галлимор, Д. В. Браун и Дж. К. Бриджер.
      1999. Агент Ньюбери 2 крупного рогатого скота генетически более близок к вирусу SRSV человека, чем к калицивирусам животных. Вирусология254 : 1-5.

    10. 10.

      Дастджерди А. М., Д. Р. Снодграсс и Дж. К. Бриджер.
      2000. Характеристика бычьего кишечноподобного калици-подобного вируса, агент Ньюбери 1.FEMS Microbiol. Lett.192 : 125-131.

    11. 11.↵

      Deng, Y., CA Batten, BL Liu, PR Lambden, M. Elschner, H. Gunther, P. Otto, P. Schnurch, W. Eichhorn, W. Herbst, and IN Кларк.
      2003. Исследования эпидемиологии и серологической распространенности норовирусов крупного рогатого скота в Германии. J. Clin. Microbiol.41 : 2300-2305.

    12. 12.

      Дингл, К. Э., П. Р. Ламбден, Э. О. Кол и И. Н. Кларк.
      1995 г.Кишечные бактерии Caliciviridae человека: полная последовательность генома и экспрессия вирусоподобных частиц небольшого круглого структурированного вируса генетической группы II. J. Gen. Virol.76 : 2349-2355.

    13. 13.↵

      Farkas, T., S.A. Thornton, N. Wilton, W. Zhong, M. Altaye и X. Jiang.
      2003. Гомологичный и гетерологичный иммунный ответ на норволк-подобные вирусы среди членов экипажа после вспышек острого гастроэнтерита на 2 судах ВМС США. J. Infect. Dis.187 : 187-193.

    14. 14.↵

      Günther, H., and P. Otto.
      1987. Диарея у молодых телят. 7. «Закенвирус» (агент 117/80 в Йене) — новый возбудитель диареи у телят. Arch. Exp. Ветеринармед.41 : 934-938.

    15. 15.↵

      Günther, H., P. Otto, and P. Heilmann.
      1984. Диарея у молодых телят. 6. Определение патогенности коронавируса крупного рогатого скота и неидентифицированного икосаэдрического вируса. Arch. Exp. Ветеринарная медицина.38 : 781-792.

    16. 16.↵

      Хейл, А. Д., Т. Н. Танака, Н. Китамото, М. Чиарлет, Х. Цзян, Н. Такеда, Д. В. Браун и М. К. Эстес.
      2000. Идентификация эпитопа, общего для геногруппы 1 «норвалькоподобные вирусы». J. Clin. Microbiol.38 : 1656-1660.

    17. 17.

      Хан, М. Г., Дж. Р. Смайли, К. Томас и Л. Дж. Саиф.
      2004. Генетическая рекомбинация между двумя генотипами бычьих норовирусов (BoNV) геногруппы III и разнообразие капсидных последовательностей среди BoNV и кишечных калицивирусов крупного рогатого скота, подобных Небраске.J. Clin. Microbiol.42 : 5214-5224.

    18. 18.↵

      Херрманн, Дж. Э., Н. Р. Блэклоу, С. М. Мацуи, Т. Л. Льюис, М. К. Эстес, Дж. М. Болл и Дж. П. Бринкер.
      1995. Моноклональные антитела для обнаружения антигена вируса Norwalk в стуле. J. Clin. Microbiol.33 : 2511-2513.

    19. 19.↵

      Хамфри, В., А. Далке и К. Шультен.
      1996. VMD: визуальная молекулярная динамика. J. Mol. График 14 : 33-38.

    20. 20.↵

      Цзян, X., В. М. Чжун, Т. Фаркас, П. В. Хуанг, Н. Уилтон, Э. Барретт, Д. Фултон, Р. Морроу и Д. О. Матсон.
      2002. Экспрессия бакуловируса и антигенная характеристика капсидных белков трех норволк-подобных вирусов. Arch. Virol.147 : 119-130.

    21. 21.↵

      Китамото, Н., Т. Танака, К. Натори, Н. Такеда, С. Наката, X. Цзян и М. К. Эстес.
      2002. Перекрестная реактивность между несколькими рекомбинантными калицивирусными вирусоподобными частицами (VLP) с моноклональными антителами, полученными от мышей, иммунизированных перорально одним типом VLP.J. Clin. Microbiol.40 : 2459-2465.

    22. 22.↵

      Laemmli, U. K.
      1970. Расщепление структурных белков во время сборки головки бактериофага Т4. Nature227 : 680-685.

    23. 23.↵

      Льюис, Д. К.
      1990. Три серотипа норволкоподобного вируса продемонстрированы с помощью твердофазной иммунной электронной микроскопии. J. Med. Virol.30 : 77-81.

    24. 24.↵

      Линь, Ю.П., К. Николас, Ф. Р. Болл, Б. Маклафлин и Ф. Р. Бишай.
      1991. Обнаружение норволкоподобного вируса и специфических антител с помощью иммуно-электронной микроскопии с иммунными комплексами коллоидного золота. J. Virol. Методы 35 : 237-253.

    25. 25.↵

      Лю Б. Л., П. Р. Ламбден, Х. Гюнтер, П. Отто, М. Эльшнер и И. Н. Кларк.
      1999. Молекулярная характеристика кишечного калицивируса крупного рогатого скота: связь с норволк-подобными вирусами. J. Virol.73 : 819-825.

    26. 26.↵

      Lucchelli, A., S. Y. Kang, M. K. Jayasekera, A. V. Parwani, D. H. Zeman, and L. J. Saif.
      1994. Изучение серотипов G6 и G10 ротавирусов крупного рогатого скота группы А от диареи говядины и молочных телят с использованием моноклональных антител в ELISA. J. Vet. Диаг. Исследование 6 : 175-181.

    27. 27.↵

      Маес, Р. К., Д. Л. Грумс, А. Г. Уайз, К. Хан, В. Чесицки, Л. Хансон, М. Л. Викерс, К. Каниц и Р. Холланд.
      2003. Оценка группы людей тестом на ротавирус для обнаружения ротавируса крупного рогатого скота на месте. J. Clin. Microbiol.41 : 290-294.

    28. 28. №

      Ноэль, Дж. С., Т. Андо, Дж. П. Лейте, К. Ю. Грин, К. Э. Дингл, М. К. Эстес, Ю. Сето, С. С. Монро и Р. И. Гласс.
      1997. Корреляция иммунных ответов пациентов с генетически охарактеризованными небольшими вирусами с круглой структурой, участвующими во вспышках небактериального острого гастроэнтерита в Соединенных Штатах, с 1990 по 1995 год.J. Med. Virol. 53 : 372-383.

    29. 29.↵

      Okada, S., S. Sekine, T. Ando, ​​Y. Hayashi, M. Murao, K. Yabuuchi, T. Miki и M. Ohashi.
      1990. Антигенная характеристика небольших вирусов с круглой структурой с помощью иммунной электронной микроскопии. J. Clin. Microbiol.28 : 1244-1248.

    30. 30.↵

      Оливер, С. Л., Д. У. Браун, Дж. Грин и Дж. К. Бриджер.
      2004. Химерный кишечный калицивирус крупного рогатого скота: доказательства геномной рекомбинации в геногруппе III норовируса рода Caliciviridae.Вирусология 326 : 231-239.

    31. 31.↵

      Оливер, С. Л., А. М. Дастджерди, С. Вонг, Л. Эль Аттар, К. Галлимор, Д. В. Браун, Дж. Грин и Дж. К. Бриджер.
      2003. Молекулярная характеристика кишечных калицивирусов крупного рогатого скота: отдельная третья геногруппа норовирусов (Norwalk-подобные вирусы), вряд ли представляющие опасность для человека. J. Virol.77 : 2789-2798.

    32. 32.↵

      Пелоси, Э., П. Р. Ламбден, Э. О. Кол, Б. Лю, К.Дингл, Ю. Дэн и И. Н. Кларк.
      1999. Сероэпидемиология норвалькоподобных вирусов геногруппы 1 и геногруппы 2 в Италии. J. Med. Virol. 58 : 93-99.

    33. 33.↵

      Reynolds, D. J., J. H. Morgan, N. Chanter, P. W. Jones, J. C. Bridger, T. G. Debney, and K. J. Bunch.
      1986. Микробиология диареи телят на юге Великобритании. Вет. Рек.119 : 34-39.

    34. 34.↵

      Смайли, Дж. Р., А. Э. Хоэт, М.Травен, Х. Цунэмицу и Л. Дж. Саиф.
      2003. ПЦР с обратной транскрипцией для обнаружения бычьих кишечных калицивирусов (БЭК) и анализ генетических взаимоотношений между БЭК и калицивирусами человека. J. Clin. Microbiol.41 : 3089-3099.

    35. 35.↵

      Снодграсс, Д. Р., Х. Р. Терцоло, Д. Шервуд, И. Кэмпбелл, Дж. Д. Мензис и Б. А. Синг.
      1986. Этиология диареи у молодых телят. Вет. Рек.119 : 31-34.

    36. 36.↵

      Stott, A. W., and G. Gunn.
      1995. Затраты на энтерит крупного рогатого скота у телят-молокососов. Scottish Agric. Экон. Ред. 1995 г. : 83-88.

    37. 37.↵

      van der Poel, W. H., H. R. van der, F. Verschoor, H. Gelderblom, J. Vinje и M. P. Koopmans.
      2003. Эпидемиология норволк-подобных вирусных инфекций крупного рогатого скота в Нидерландах. Вет. Microbiol.92 : 297-309.

    38. 38.↵

      van der Poel, W.Х., Дж. Винье, Х. Р. ван дер, М. И. Эррера, А. Виво и М. П. Купманс.
      2000. Норуолк-подобные гены калицивирусов сельскохозяйственных животных. Emerg. Заразить. Дис.6 : 36-41.

    39. 39.↵

      Wise, A. G., S. S. Monroe, L. E. Hanson, D. L. Grooms, D. Sockett, and R. K. Maes.
      2004. Молекулярная характеристика норовирусов, обнаруженных в стуле с диареей у телят Мичигана и Висконсина: циркуляция двух различных подгрупп. Virus Res.100 : 165-177.

    40. 40.↵

      Вуд, Г. Н., и Дж. К. Бриджер.
      1978. Выделение мелких вирусов, похожих на астровирусы и калицивирусы, от острого энтерита телят. J. Med. Microbiol.11 : 441-452.

    41. 41.↵

      Йода, Т., Ю. Судзуки, Ю. Терано, К. Ямазаки, Н. Сакон, Т. Кузугути, Х. Ода и Т. Цукамото.
      2003. Точная характеристика моноклональных антител, специфичных к норовирусу (Norwalk-подобный вирус), с широкой реактивностью.J. Clin. Microbiol.41 : 2367-2371.

    42. 42.↵

      Йода, Т., Ю. Терано, Ю. Судзуки, К. Ямазаки, И. Оиси, Э. Утагава, А. Шимада, С. Мацуура, М. Накадзима и Т. Шибата.
      2000. Характеристика моноклональных антител, генерируемых против капсидного белка GII вируса Norwalk, экспрессированного в Escherichia coli. Microbiol. Immunol.44 : 905-914.

    Анализ вирусологии у пациентов, инфицированных HCV генотипа 1, получавших комбинацию симепревира и TMC647055 / ритонавира, с рибавирином и без него и JNJ-56914845 | Журнал вирусологии

  • 2.

    Lam BP, Jeffers T, Younoszai Z, Fazel Y, Younossi ZM. Меняющийся ландшафт терапии вирусом гепатита С: акцент на лечение без интерферона. Therap Adv Гастроэнтерол. 2015; 8: 298–312.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 3.

    Павлоцкий JM, Feld JJ, Zeuzem S, Hoofnagle JH. От гепатита не-А и не-В к лечению от вируса гепатита С. J Hepatol. 2015; 62: S87–99.

    CAS
    Статья
    PubMed

    Google ученый

  • 5.

    Буржуа С., Ван Влиерберг Х., Морено С., Орлент Х, Невенс Ф., Арасте К. и др. Эффективность, безопасность и фармакокинетика симепревира и TMC647055 / ритонавира с рибавирином или без него и JNJ-56914845 при инфекции HCV генотипа 1. BMC Gastroenterol. 2017; 17:26.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 6.

    Ленц О., Вербиннен Т., Фивери Б., Тамбайзер Л., Виджген Л., Петерс М. и др. Вирусологический анализ изолятов ВГС от пациентов с генотипом 1, получавших симепревир плюс пегинтерферон / рибавирин в исследованиях фазы IIb / III.J Hepatol. 2015; 62: 1008–14.

    CAS
    Статья
    PubMed

    Google ученый

  • 7.

    Лавиц Э., Сулковски М.С., Галиб Р., Родригес-Торрес М., Юноси З.М., Коррегидор А. и др. Симепревир плюс софосбувир, с рибавирином или без него, для лечения хронической инфекции вируса гепатита С генотипа 1 у лиц, не ответивших на пегилированный интерферон и рибавирин, и пациентов, не получавших лечение: рандомизированное исследование COSMOS. Ланцет. 2014; 384: 1756–65.

    CAS
    Статья
    PubMed

    Google ученый

  • 8.

    Морено С., Хезоде С., Марселлин П., Буржуа С., Франк С., Самуэль Д. и др. Эффективность и безопасность симепревира с PegIFN / рибавирином у наивных или опытных пациентов, инфицированных хроническим генотипом ВГС 4. J Hepatol. 2015; 62: 1047–55.

    CAS
    Статья
    PubMed

    Google ученый

  • 9.

    Лавиц Э., Матусов Г., ДеДжесус Э., Йошида Э.М., Фелизарта Ф., Галиб Р. и др.Симепревир плюс софосбувир у пациентов с хронической инфекцией вируса гепатита С генотипа 1 и циррозом: исследование фазы 3 (OPTIMIST-2). Гепатология. 2016; 64: 360–9.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 10.

    Кво П., Гитлин Н., Нахасс Р., Бернштейн Б., Ройтер С., Шифф Е. и др. Симепревир плюс софосбувир (12 и 8 недель) у инфицированных HCV генотипа 1 пациентов без цирроза: OPTIMIST-1, фаза 3, рандомизированное исследование.Гепатология. 2016; 64: 370–80.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 11.

    Девогелаэре Б., Берке Дж. М., Виджген Л., Дехертог П., Франсен Е., Клейрен Е. и др. TMC647055, мощный ненуклеозидный ингибитор полимеразы NS5B вируса гепатита С с перекрестным генотипическим покрытием. Антимикробные агенты Chemother. 2012; 56: 4676–84.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 12.

    Leempoels J, Reesink H, Bourgeois S, Vijgen L, Rouan MC, Vandebosch A и др. Безопасность для человека, фармакокинетика и противовирусная активность TMC647055, нового ингибитора ненуклеозидной полимеразы HCV. 2011. http://www.natap.org/2011/AASLD/AASLD_04.htm. По состоянию на 23 ноября 2016 г.

    Google ученый

  • 13.

    Буржуа С., Рисинк Х.В., Лемпоэлс Дж., Виджген Л., Руан М.С., Мариен К. и др. Комбинированная терапия TMC647055 с симепревиром (TMC435) у пациентов с хроническим гепатитом C [аннотация].J Hepatol. 2013; 58: S483.

    Артикул

    Google ученый

  • 14.

    Уокер Дж., Кросби Р., Ван А., Волду Э., Ваматеван Дж., Войтенлейтнер С. и др. Доклиническая характеристика GSK2336805, нового ингибитора репликации вируса гепатита С, который выбирает устойчивость к NS5A. Антимикробные агенты Chemother. 2014; 58: 38–47.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 15.

    Wilfret DA, Walker J, Adkison KK, Jones LA, Lou Y, Gan J и др. Безопасность, переносимость, фармакокинетика и противовирусная активность GSK2336805, ингибитора вируса гепатита С (HCV) NS5A, у здоровых и хронически инфицированных вирусом гепатита C генотипа 1. Антимикробные агенты Chemother. 2013; 57: 5037–44.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 16.

    Колецки Д., Пэттери Т, Фивери Б., Ванхурен Л., Стуйвер Л.Дж.Амплификация и секвенирование протеазы NS3 / 4A вируса гепатита C и областей полимеразы NS5B для выявления генотипической устойчивости клинических изолятов подтипов 1a и 1b. Методы Мол биол. 2013; 1030: 137–49.

    CAS
    Статья
    PubMed

    Google ученый

  • 17.

    Thys K, Verhasselt P, Reumers J, Verbist BM, Maes B, Aerssens J. Оценка производительности платформы массового параллельного секвенирования Illumina для глубокого анализа секвенирования вариантов вирусных меньшинств.J Virol Methods. 2015; 221: 29–38.

    CAS
    Статья
    PubMed

    Google ученый

  • 18.

    Nyanguile O, Devogelaere B., Vijgen L., Van den Broeck W., Pauwels F, Cummings MD, et al. Профилирование подтипа 1a / 1b ненуклеозид-полимеразных ингибиторов вируса гепатита С. J Virol. 2010. 84: 2923–34.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 19.

    Vijgen L, Verbeeck J, van Kerckhove B, Berke JM, Koletzki D, Fanning G, et al. Анализ фенотипирования на основе клеточных репликонов для определения чувствительности клинических изолятов вируса гепатита С к ингибиторам протеазы NS3 / 4A. Методы Мол биол. 2013; 1030: 105–17.

    CAS
    Статья
    PubMed

    Google ученый

  • 20.

    Verbinnen T, Fevery B, Vijgen L, Jacobs T., De Meyer S, Lenz O. Активность симепревира in vitro против клинических изолятов вируса гепатита C генотипа-1 и ее корреляция с последовательностью NS3 и сайт-направленными мутантами .Антимикробные агенты Chemother. 2015; 59: 7548–57.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 21.

    Хуанг В., Ньютон А., Кук Дж., Тома Дж., Франтцелль А., Чоу С. и др. Разработка отчетов о тестировании рекомбинантных репликонов для характеристики ингибиторов протеаз NS5A и NS3 / 4A HCV. Противовирусные препараты Ther. 2011; 16 (Приложение 1): A29.

  • 22.

    Ленц О., Вербиннен Т., Лин Т.-И, Вийген Л., Каммингс М.Д., Линдберг Дж. И др.Профиль устойчивости in vitro ингибитора протеазы NS3 / 4A вируса гепатита C TMC435. Антимикробные агенты Chemother. 2010; 54: 1878–87.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 23.

    Фрид М.В., Бути М., Доре Г.Дж., Флисиак Р., Ференчи П., Якобсон И. и др. Симепревир (TMC435) с пегилированным интерфероном и рибавирином один раз в сутки при гепатите C генотипа 1, не получавшем лечения: рандомизированное исследование PILLAR. Гепатология.2013; 58: 1918–29.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 24.

    Форнс X, Лавиц Э., Зеузем С., Гейн Э., Броновицкий Дж. П., Андреоне П. и др. Симепревир с пегинтерфероном и рибавирином приводит к высоким показателям УВО у пациентов с генотипом 1 HCV, у которых возник рецидив после предыдущей терапии: исследование фазы 3. Гастроэнтерология. 2014; 146: 1669–79.

    CAS
    Статья
    PubMed

    Google ученый

  • 25.

    Якобсон И.М., Доре Г.Дж., Фостер Г.Р., Фрид М.В., Раду М., Рафальский В.В. и др. Симепревир с пегилированным интерфероном альфа 2а плюс рибавирин у не получавших лечения пациентов с хронической инфекцией вируса гепатита С генотипа 1 (QUEST-1): рандомизированное двойное слепое плацебо-контролируемое исследование фазы 3. Ланцет. 2014; 384: 403–13.

    CAS
    Статья
    PubMed

    Google ученый

  • 26.

    Пурдад Ф., Лавиц Э., Каудли К.В., Коэн Д.Э., Подсадэки Т., Зиггелков С. и др.Исследовательское исследование пероральной комбинированной противовирусной терапии гепатита С. N Engl J Med. 2013; 368: 45–53.

    CAS
    Статья
    PubMed

    Google ученый

  • 27.

    Кришнан П., Трипати Р., Шнелл Дж., Райш Т., Бейер Дж., Ирвин М. и др. Анализ устойчивости исходных и новых вариантов лечения генотипа 1 вируса гепатита С в исследовании AVIATOR с паритапревиром-ритонавиром, омбитасвиром и дасабувиром. Антимикробные агенты Chemother.2015; 59: 5445–54.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 28.

    Февери Б., Виджген Л., Ван Эйген В., Джесснер В., Корбетт С., Шлаг М. и др. Стабильный профиль устойчивости к симепревиру у пациентов, инфицированных генотипом 1 вируса гепатита С, у которых не получалось использовать симепревир без интерферона по сравнению с режимами, содержащими интерферон [аннотация]. J Hepatol. 2016; 64: S399.

    Артикул

    Google ученый

  • 29.

    Сарразин С. Важность устойчивости к прямым противовирусным препаратам при ВГС-инфекции в клинической практике. J Hepatol. 2016; 64: 486–504.

    Артикул
    PubMed

    Google ученый

  • 30.

    Wyles D, Mangia A, Cheng W., Shafran A, Schwabe C., Ouyang W., et al. Долгосрочная персистенция вариантов NS5A HCV после лечения ингибитором NS5A ледипасвиром. J Hepatol. 2015; 62 (Приложение 2): S221.

  • 31.

    Fevery B, Thys K, Van Eygen V, Verbinnen T, Van Rossem E, Buelens A, et al.Наличие и сохранение устойчивых вариантов вируса гепатита С меньшинства у пациентов, инфицированных генотипом 1, получавших симепревир / пегинтерферон / рибавирин. Открытый форум Infect Dis. 2016; 3: ofw052.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • Posted in Разное

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *